Outline
Comptes Rendus

Physiology / Physiologie
Comparative effect of potassium on K and Na uptake and transport in two accessions of Arabidopsis thaliana during salinity stress
Comptes Rendus. Biologies, Volume 332 (2009) no. 9, pp. 784-794

Abstracts

Potassium-sodium interaction was compared in two natural accessions of Arabidopsis thaliana, Columbia-0 and NOK2. Seedlings were grown in the presence of 0 or 50 mM NaCl and 0.1; 0.625 or 2.5 mM K+. At the lowest K+ concentration, salt treatment inhibited both K+ uptake and growth. Increasing the K+ availability did not modified salt response in Columbia-0, but restored nearly normal net K+ uptake in NaCl condition and alleviated NaCl growth reduction in NOK2. The effect of K+ and NaCl on transcript level of several K+ and Na+ transporters in both shoots and roots was assessed using semi-quantitative RT-PCR. The mRNA abundance of the NHX1 and SOS1 Na+/H+ antiporters was significantly increased by 50 mM NaCl in the two accessions. NHX1, which is responsible for Na+ sequestration into vacuoles, was more up-regulated in NOK2 leaves than in Columbia-0's in NaCl stress condition. AKT1, which is the major channel involved in K+ absorption, was down-regulated in salt stress condition, but was not responding to K+ treatments. Only in NOK2, SKOR and AKT2, which respectively control xylem and phloem K+ transport, were markedly up-regulated by 2.5 mM K+ in both roots and shoots, independently of NaCl. Phenotypic and gene expression analyses suggest that the relative salt tolerance of NOK2 is mainly due to a high ability to sequester Na+ in the vacuole and to take up and transport K+. Up-regulation of SKOR and AKT2 by K+, and of NHX1 by NaCl could participate in determining this phenotype.

L'interaction potassium-sodium est comparée entre deux lots d'Arabidopsis thaliana, référencés Columbia-0 et NOK2, issus de population naturelle. Les plantes sont cultivées en présence de 0.1 ; 0.625 ou 2.5 mM K+, avec ou sans NaCl 50 mM. A la plus faible concentration de K+, le sel diminue l'absorption de K+ et la vitesse de croissance. L'augmentation de la concentration de K+ en présence de sel ne modifie pas l'absorption de cet ion chez Columbia-0, mais elle la rétablit à sa valeur normale, tout en restaurant la croissance chez NOK2. Les effets de K+ et de NaCl sur l'abondance des transcrits de quelques systèmes de transport de K+ et Na+ dans les parties aériennes et les racines sont étudiés à l'aide d'une RT-PCR semi-quantitative. Le niveau de transcription des gènes des deux antiports Na+/H+ NHX1 et SOS1 est significativement augmenté en présence de NaCl pour les deux accessions. NHX1, antiport responsable de la séquestration de Na+ dans les vacuoles, est davantage exprimé dans les feuilles de NOK2 par comparaison avec Columbia-0, en présence de NaCl. Quant à AKT1, canal majeur impliqué dans l'absorption de K+, il est sous exprimé en présence de sel, mais il est insensible à la variation de la concentration de K+. Chez NOK2, SKOR et AKT2, qui codent des canaux impliqués dans le contrôle du transport de K+ respectivement dans le xylème et le phloème, sont surexprimés en présence de 2.5 mM K+ dans les racines et les feuilles, indépendamment de NaCl. Cette comparaison des phénotypes et de l'expression des gènes suggère que la tolérance au sel de NOK2 est due essentiellement à sa forte capacité de séquestrer Na+ dans les vacuoles et de prélever et de transporter K+. La surexpression de SKOR et AKT2 par K+, et de NHX1 par NaCl pourraient participer dans la détermination de ce phénotype.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2009.05.003
Keywords: Arabidopsis thaliana, Sodium chloride, K+ supply, Semi quantitative RT-PCR, Potassium transporters

Rym Kaddour  1 ; Nawel Nasri  1 ; Sabah M'rah  1 ; Pierre Berthomieu  2 ; Mokhtar Lachaâl  1

1 Physiologie et biochimie de la tolérance au sel des plantes, faculté des sciences de Tunis, campus universitaire, 1060 Tunis, Tunisia
2 UMR biochimie & physiologie moléculaire des plantes, Montpellier SupAgro, Institut national de la recherche agronomique, Centre national de la recherche scientifique, Université Montpellier II, place Viala, 34060 Montpellier cedex 1, France
Rym Kaddour; Nawel Nasri; Sabah M'rah; Pierre Berthomieu; Mokhtar Lachaâl. Comparative effect of potassium on K and Na uptake and transport in two accessions of Arabidopsis thaliana during salinity stress. Comptes Rendus. Biologies, Volume 332 (2009) no. 9, pp. 784-794. doi: 10.1016/j.crvi.2009.05.003
@article{CRBIOL_2009__332_9_784_0,
     author = {Rym Kaddour and Nawel Nasri and Sabah M'rah and Pierre Berthomieu and Mokhtar Lacha\^al},
     title = {Comparative effect of potassium on {K} and {Na} uptake and transport in two accessions of {\protect\emph{Arabidopsis} thaliana} during salinity stress},
     journal = {Comptes Rendus. Biologies},
     pages = {784--794},
     year = {2009},
     publisher = {Elsevier},
     volume = {332},
     number = {9},
     doi = {10.1016/j.crvi.2009.05.003},
     language = {en},
}
TY  - JOUR
AU  - Rym Kaddour
AU  - Nawel Nasri
AU  - Sabah M'rah
AU  - Pierre Berthomieu
AU  - Mokhtar Lachaâl
TI  - Comparative effect of potassium on K and Na uptake and transport in two accessions of Arabidopsis thaliana during salinity stress
JO  - Comptes Rendus. Biologies
PY  - 2009
SP  - 784
EP  - 794
VL  - 332
IS  - 9
PB  - Elsevier
DO  - 10.1016/j.crvi.2009.05.003
LA  - en
ID  - CRBIOL_2009__332_9_784_0
ER  - 
%0 Journal Article
%A Rym Kaddour
%A Nawel Nasri
%A Sabah M'rah
%A Pierre Berthomieu
%A Mokhtar Lachaâl
%T Comparative effect of potassium on K and Na uptake and transport in two accessions of Arabidopsis thaliana during salinity stress
%J Comptes Rendus. Biologies
%D 2009
%P 784-794
%V 332
%N 9
%I Elsevier
%R 10.1016/j.crvi.2009.05.003
%G en
%F CRBIOL_2009__332_9_784_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

Potassium is the most abundant inorganic cation in the cytoplasm of all organisms. In plants, it plays a crucial role in osmoregulation, turgor maintenance and cell expansion [1]. Sodium ion can compete with K+ and inhibit transport and metabolic processes depending on K+. Since Na+ is frequently present at higher concentrations than K+ in soils, most plants must have transport systems with high selectivity for K+ against Na+ [2]. Plants also possess transport systems that compartmentalize Na+ into the vacuole. This is an essential function in protecting the cytosolic biochemical machinery and ensuring a balance against the low extracellular osmotic potential created by salt stress [3,4]. Plants feature both inter-specific and intra-specific variations for K+ and Na+ transport. NaCl-tolerant varieties generally maintain a high cytosolic K+/Na+ ratio, when they are in presence of salty medium [5–9]. Considering the K+ vs. Na+ selectivity as the ratio between the K+/Na+ ratio in leaves and the K+/Na+ ratio in the soil solution, a diversity analysis performed in A. thaliana evidenced a strong correlation between salt tolerance and K+ vs. Na+ selectivity [10]. The two accessions displaying extreme phenotypes were Columbia-0, which showed a 50% reduction in shoot dry weight and a K+ vs. Na+ selectivity of 1 in response to salt stress, and NOK2, which showed no reduction in shoot dry weight and a K+ vs. Na+ selectivity of 5.

The causes of the K+ vs. Na+ selectivity remain unclear. At least 35 genes present in the Arabidopsis genome are thought to encode various K+ channels or transporters [11]. The actual functions of some of these genes have been inferred from reverse genetic approaches, in which gene disruption was associated with lower K+ content and reduced cell or whole plant growth as compared to wild type [12–15]. Passive uptake of K+ into roots is mediated by K+-selective channels located on the plasma membrane of root cells such as AKT1 [12,14,16,17]. AKT1 disruption inhibits Arabidopsis growth at low K+ concentration [13]. This gene is differently regulated by salt in salt-tolerant and salt-sensitive rice varieties [8]. Potassium uptake is also ensured by the HAK5 gene. This transporter contributes to high-affinity potassium uptake in Arabidopsis roots [17]. Long distance transport of K+ involves SKOR [18] and AKT2 [19], two channels involved in K+ secretion into the xylem in roots and into the phloem in shoots, respectively. Both AKT1 and SKOR are present at loci that coincide with QTLs for K+ content in Arabidopsis leaves [20].

Information relative to the transporters involved in sodium transport is more limited. Vacuolar compartmentalization of Na+ is achieved by the action of Na+/H+ antiporters present on the tonoplast. AtNHX1 is one of these antiporters; it can mediate Na+ and K+ coupled transport in vacuoles [21] and its over-expression improves plant salt tolerance [21–23]. AtHKT1 has been shown to control Na+ homeostasis and to regulate potassium nutrient status in planta [24]. Recently, another Na+/H+ antiporter (NHX5) has been identified as playing a role in salt tolerance by controlling the accumulation of Na+ and K+ in shoots [25]. Sodium can also be moved out of the cell by SOS1, which encodes a plasma membrane Na+/H+ antiporter controlling long distance Na+ translocation from root to shoot in Arabidopsis. Over-expressing SOS1 in this species increases salt tolerance [26].

The purpose of this study was to explore the combined effects of a mild salt stress and increasing K+ supplies on the two Arabidopsis thaliana natural accessions, Columbia-0 and NOK2, at the phenotypic and molecular levels. A semi-quantitative RT-PCR method was used to monitor changes in the transcript abundance of the AKT1, AKT2, SKOR, NHX1 and SOS1 K+ and Na+ transporters in relation to the varying Na+ and K+ treatments.

2 Materials and methods

Seeds of NOK2 and Columbia-0 accessions provided by the Nottingham Arabidopsis Stock Centre (references N1403 and N907, respectively), were grown in pots containing a 1:2 (v:v) mixture of sand and peat, and placed in a culture chamber with a 12 h photoperiod (150 μmol m−2 s−1 PAR). The substrate contained 4.9 mg/Kg of K+ and 4.6 mg/Kg Na+. The seedlings were irrigated with distilled water during the first 10 days, and then with a nutrient solution [27] diluted to the quarter and composed of: 1.0 mM Mg SO4, 0.625 mM, KH2PO4, 0.5 mM Ca(NO3)2; 1.25 mM NH4NO3; 0.04 μM MnSO4, 0.5 μM ZnSO4, 0.05 H3BO3, 0.02 MoO3 et 3 μM FeEDTA, during 13 days. The first harvest was then performed. The plants were thereafter irrigated with the same nutrient solution modified to contain 0.1, 0.625 or 2.5 mM final potassium concentration and 0 or 50 mM NaCl. In the control medium, potassium was added as 0.625 mM KH2PO4. In the treatment with the lowest K+ concentration, potassium was added as 0.1 mM KH2PO4, and the medium was supplemented with 0.525 Na H2PO4 to maintain P level. Seventeen days later, plants were harvested. For RT-PCR analyses, samples were frozen in liquid nitrogen and stored at 80°C. Leaves and roots were analyzed separately.

2.1 Phenotypic and elemental analyses

Fresh and dry matter of leaves and roots were determined. For each rosette, all the leaves were cut and photographed, and the individual leaf surface areas were measured using the Optimas® software. Roots were collected by submerging the whole root system with the substrate attached to it in 120 ml distilled water. Three rinsing steps were sufficient to get rid of the substrate and rinse the roots. Roots and leaves of each plant were then separately digested in 0.1N HNO3. The concentrations of K+ and Na+ in the clear extracts were measured by flame photometry (Jenway PFP7, using butane air flame).

According to [28], rate of ion net uptake (Jupt) was calculated for each time interval, as

Jupt=ΔItotLn(Wr2/Wr1)/ΔWrΔt
where Δ stands for the difference between times t2 and t1 (days), Itot is the average amount of ion per plant (mmol) calculated from ion concentrations (mmol g−1 DW) and plant dry weights (Wr, g). Ln(Wr2/Wr1)/Wr is the logarithmic mean of the root dry weight (g) calculated over the Δt interval. Logarithmic mean was used instead of arithmetic mean, because growth kinetics was expected to be exponential rather than linear within the studied time interval.

2.2 Statistics

Data are presented as the mean of nine plants for each treatment. Significant differences between treatments were analysed using ANOVA and mean comparison with Duncan post hoc test (Statistica®). Values were calculated at the P<0.05 probability level.

2.3 RNA isolation

Plant material (3 plants pooled) was ground in liquid nitrogen, then resuspended in a 0.1 M Tris-HCl, pH 9 buffer containing 1% (w/v) SDS, 10 mM EDTA and 50 mM β-Mercaptoethanol. The mixture was extracted twice with phenol: chloroform:isoamyl alcohol (25:24:1, v:v:v). One tenth volume of 3M sodium acetate pH 5.2 and 2.5 volumes of ethanol were added to the supernatant and the mixture was left on ice for at least one hour for nucleic acid precipitation. After centrifugation at 15,000g for 20 min, the pellet was resuspended in deionised water. For RNA precipitation, one volume of 4 mM LiCl was added and the mixture was placed on ice for a minimum of two hours. After 45 min of 15,000g centrifugation, RNA pellets were air-dried for 15 to 30 min, and resuspended in diethyl pyrocarbonate-treated water. RNA was quantified by spectrophotometry. To ensure the quality of RNA, samples were assessed by formaldehyde-denaturing agarose gel electrophoresis.

2.4 Semi-quantitative RT-PCR

For reverse transcription, 1 μg RNA was incubated with 0.5 μg oligo-dT at 70 °C for 10 min. The reaction mixture was then brought to 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 0.5 mM each dNTP and 200 U M-MLV reverse transcriptase (Promega) and incubated at 42 °C for 1 hour. The reaction was stopped by a 15 min long incubation at 70 °C. PCR reactions were conducted using an Eppendorf thermal cycler at 94 °C for 2 min to denature the samples, followed by 30 PCR cycles (30 s at 94 °C, 45 s at 60 °C, 1 min at 72 °C), and a 5 min final extension step at 72 °C. The number of amplification cycles (30) was determined to ensure that all amplification reactions were stopped in the exponential phase. The primers cited in Table 1 were designed for the gene-specific amplification of transcripts. They were designed to span an intron to distinguish PCR products generated from cDNA versus genomic DNA. The PCR reaction was resolved by electrophoresis on a 1 to 2% (w/v) agarose gel stained with ethidium bromide. Gel images were photographed and quantified using Image J version 1.37 software for Windows. The relative intensity of each band in each sample was quantified using spot densitometry and the data were calibrated against the quantities of the Ef-1α gene. mRNA accumulation measurements were done in triplicate for all the genes. mRNA accumulation measurements were done in triplicate for all the genes.

Table 1

Forward and reverse specific primers used for RT PCR amplification and size of the amplified fragment.

Gene Primer sequence (53) Product length (pb)
Genomic DNA cDNA
NHX1 At5g27150 Forward ACCGGTCTGATAAGTGCGTATGTTATC 1464 911
Reverse GTTACCCTCAAGCCTTACTAAGATC
SOS1 At2g01980 Forward CAAATAAAATGACGACTGTAATCGAC 1551 966
Reverse GTCCTTGCAAATGCAGCATAAAAC
AKT1 At2g26650 Forward CCGCAACTTCAACTACTTTTGGGTCCGATGCG 591 510
Reverse GGGAGTGCATCAAGAGTTTCTTGCTGTTGCAG
AKT2 At4g22200 Forward CAGGAGAAATATAATGGACCTCAAG 408 294
Reverse GGGTAAACCCACGCAGAGTATG
SKOR At3g02850 Forward CGTCGAGCTTTATTGCACTCAC 510 431
Reverse GCAATCCGCAAATGTCCGGTAATCTGACC
Ef1α At1g07920 Forward ATGGGTAAAGAGAAGTTTCACATC 830 730
Reverse CCAATCTTGTAGACATCCTGAAG

3 Results

3.1 Growth responses of the Columbia-0 and NOK2 A. thaliana accessions to the combination of variable potassium nutrition and NaCl treatments

The Columbia-0 and NOK2 accessions were not equally sensitive to increases in the K+ nutrition (Fig. 1). Whether NaCl was present or not in the culture medium, growth of Columbia-0 plants was not significantly altered in response to the increase in K+ concentration in the medium. In contrast, when the K+ concentration in the medium was increased from 0.1 mM to 2.5 mM, the final whole plant biomass of the NOK2 accession increased by ∼15% in cases where no NaCl was present and by ∼30% in the presence of 50 mM NaCl. The growth decrease observed for both accessions in response to salt at 0.1 mM K+ was suppressed upon increase in the K+ supply only in NOK2 (Fig. 1). A protective effect against NaCl stress caused by increasing the K+ supply was thus demonstrated only for the NOK2 accession.

Fig. 1

Combined effect of increasing K+ concentration in the culture medium and applying or not a 50 mM NaCl treatment on growth of Columbia-0 (Col) and NOK2 plants. The 0.1, 0.625 and 2.5 mM K+ and 0 or 50 mM NaCl treatments were applied to 23 day-old individual plants and lasted 17 days. 50 mM NaCl: black symbols; 0 mM NaCl: white symbols. NOK2: triangles; Columbia-0: circles. Means ± confidence intervals (n = 9; p = 0.05).

Dissecting the growth response to understand what would be the cause of the observed differences between the two accessions did not give a clear answer. The total leaf surface per plant increased by +25% (Fig. 1) in response to the increase in K+ supply for both accessions. The origin of this increase was different for the two accessions. Columbia-0 produced a greater number of leaves and showed symptoms of necrosis while NOK2 produced larger leaves without necrosis (Fig. 1). These responses were irrespective of the presence or absence of NaCl in the medium. A major difference between the two accessions was the leaf thickness. It was markedly higher for NOK2 than for Columbia-0, and increased by 25% under NaCl stress in NOK2 while it decreased by 50% in Columbia-0 (Fig. 2). In addition, increasing the K+ supply did not significantly change the leaf thickness in NOK2, while it resulted in a decrease in the leaf thickness in Columbia-0. The water content was also significantly differentially altered in an accession-dependent way, mainly in response to the presence of NaCl in the culture medium (Fig. 2). The NOK2 water content was 1/3 lower than the Columbia-0 one when no NaCl was added to the culture medium. Upon NaCl stress, it reduced by only 20% while the Columbia-0 one reduced by more than 50%, so that the Columbia-0 water content was lower than the NOK2 one upon NaCl stress. In summary, the positive effect on growth of the increase in the K+ supply could only be observed for the NOK2 accession, more particularly when the plants were grown in presence of NaCl in the culture medium. The origin of this phenotype was probably that increasing the K+ supply resulted in an increase in the leaf surface area together with the preservation of leaf hydration and leaf thickness, which positively discriminated NOK2 in comparison to Columbia-0.

Fig. 2

Combined effect of increasing K+ concentration in the culture medium and applying or not a 50 mM NaCl treatment on leaf water content and leaf thickness of Columbia-0 (Col) and NOK2 plants. The 0.1, 0.625 and 2.5 mM K+ and 0 or 50 mM NaCl treatments were applied to 23 day-old individual plants and lasted 17 days. 50 mM NaCl: black symbols; 0 mM NaCl: white symbols. NOK2: triangles; Columbia-0: circles. Means ± confidence intervals (n = 9; p = 0.05).

3.2 Effect of combining variable potassium nutrition and NaCl treatments on the K+ and Na+ net uptake and accumulation in Columbia-0 and NOK2

Leaf K+ content was strongly dependent on the level of the K+ supply to the culture medium (Fig. 3), increasing in most cases by +80% to +110% in response to an increase from 0.1 to 2.5 mM in the K+ concentration in the culture medium. The only exception was for Columbia-0 plants submitted to the-NaCl treatment: in this case, the leaf K+ content augmented by only 55% in response to medium enrichment in K+. The increase in leaf K+ content was correlated to a 25% decrease in the leaf Na+ content in NOK2 plants submitted to the NaCl treatment, but it had no impact on the leaf Na+ content in Columbia-0 plants submitted to the same NaCl treatment (Fig. 3). Notwithstanding the variation in the level of the K+ supply, NOK2 plants accumulated ∼50% more K+ and twice less Na+ in their leaves than Columbia-0 plants, so that the K+/Na+ concentration ratio varied from 0.18 to 0.37 in NOK2, and from 0.07 to 0.11 in Columbia-0.

Fig. 3

K+ and Na+ accumulation in Columbia-0 (Col) and NOK2 plants. The 0.1, 0.625 and 2.5 mM K+ and 0 or 50 mM NaCl treatments were applied to 23 day-old individual plants and lasted 17 days. A, C: leaf K+ and Na+ contents at the end of the treatments. D, E: net K+ and Na+ uptake during the 17-day long treatments. 50 mM NaCl: black symbols; 0 mM NaCl: white symbols. NOK2: triangles; Columbia-0: circles. Means ± confidence intervals (n = 9; p = 0.05). The small amounts of Na+ absorbed from solutions without added NaCl are exactly accounted for by the Na+ amounts present in the solid substrate.

The rate of ion uptake by roots was estimated by dividing the amount of ion absorbed per plant over the experiment duration to the mean root dry weight. The K+ net uptake rate was 58% lower, and much more inhibited by NaCl, in Columbia-0 than in NOK2 (Fig. 3). For plants grown on NaCl, the Na+ net uptake rate was 2 to 30 fold higher than the net K+ uptake. When K+ concentration in the culture medium was 0.1 mM, the estimated values of the Na+ net uptake rate were close to 5 mmol d−1 g−1 root DW for both Columbia-0 and NOK2. Increasing the K+ concentration from 0.1 mM to 2.5 mM resulted in a slight increase of the net Na+ uptake rate in Columbia-0 and a slight decrease in NOK2 (Fig. 3). In Columbia-0, net K+ uptake remained equally strongly inhibited by NaCl whatever the external K+ concentration, while in NOK2, virtually complete alleviation of the NaCl-induced inhibition of net K+ uptake was obtained by increasing the K+ concentration in the culture medium (Fig. 3). Altogether these results show that NOK2 was more efficient than Columbia-0 for K+ uptake, particularly in the presence of NaCl in the culture medium, and that treatment which increased K+ uptake also slowered Na+ build-up in NOK2 tissues.

3.3 Analyses of the gene expression of selected K+ and Na+ transporter

The gene expression of transporters involved in K+ and Na+ uptake and in K+ and Na+ transport between root and shoot was analysed in Columbia-0 and NOK2 plants grown on media supplemented with the already mentioned different combinations of K+ and NaCl concentrations. Semi quantitative RT-PCR analyses were done for the AKT1, AKT2 and SKOR K+ channels, and the NHX1 and SOS1 Na+/H+ antiporters. Since Ef-1α had already been demonstrated to show stable expression in plants submitted to varying K+ or Na+ external concentrations [17,29], it was used as an internal control. The mRNA abundances of NHX1 and SOS1 did not really change in response to the increase in the K+ concentration in the culture medium. They were however markedly increased in plants submitted to salt stress. SOS1 mRNA accumulation was 3 times augmented by NaCl, except in Columbia-0 shoots where this augmentation was only 2 to 2.5 times. Salt-induced NHX1 mRNA accumulation was essentially observed in the shoots. It was two fold higher in NOK2 plants than in Columbia-0 plants. The mRNA abundances of the three K+ channels were altered differently from each other in response to K+ supply and NaCl treatment. The AKT1 mRNA abundance in shoot remained the same, whatever the condition considered. AKT1 expression in roots was however strongly inhibited in response to NaCl stress, whatever the K+ concentration in the medium. Interestingly, the NaCl-induced reduction in AKT1 mRNA accumulation was slightly less pronounced in NOK2 roots (57% reduction) than in Columbia-0 ones (71% reduction). Almost no change in AKT2 and SKOR mRNA abundance was observed, except in NOK2 in response to 2.5 mM K+. Quite surprisingly, in that growing condition, AKT2 was induced but only in shoots, and SKOR was also induced, but only in roots. These responses were irrespective of the presence of NaCl in the culture medium, and were thus specific of the presence of a high K+ external supply.

In summary, the two Na+/H+ antiporters SOS1 and NHX1 and the AKT1 K+ channel displayed an alteration of their mRNA accumulation only in response to the NaCl treatment, being insensitive to changes in the K+ supply, while the AKT2 and SKOR K+ channels showed alteration of their mRNA accumulation only in response to the increasing K+ supply, being insensitive to the presence or absence of NaCl. There was a marked differential response between the two accessions for all genes: (i) increase in NHX1 mRNA accumulation in response to NaCl was greater in NOK2 than in Columbia-0; (ii) increase in SOS1 mRNA accumulation in response to NaCl was less pronounced in Columbia-0 shoots than in NOK2 ones; (iii) decrease in AKT1 mRNA accumulation in response to NaCl was slightly lower in NOK2 than in Columbia-0 and alteration of AKT; (iv) SKOR mRNA accumulation was only observed in NOK2.

4 Discussion

The comparison between the salt tolerant NOK2 and the salt sensitive Columbia-0 A. thaliana accessions revealed that NOK2 showed a higher salt tolerance than Columbia-0 that could be correlated to a greater K+ vs. Na+ selectivity [10]. Here we further analysed these two accessions and compared their performances in response to increasing K+ concentrations in the culture medium in presence vs. absence of a mild salt stress.

Our analyses confirmed that NOK2 is endowed with greater K+ vs. Na+ selectivity than Columbia-0 (Fig. 3E). The K+ content and the K+ net uptake rate were both higher in NOK2 than in Columbia-0 plants (Fig. 3), showing that NOK2 has an intrinsic high ability to absorb K+ compared to Columbia-0. Increasing K+ concentrations in the culture medium actually had a positive effect on growth in NOK2 but not in Columbia-0 (Fig. 1A). In response to the NaCl constraint, NOK2 plants showed less reduction in their growth and net K+ uptake compared to Columbia-0 plants (Figs. 1, 3). Using split root system approaches on glycophyte and halophyte species, several works have demonstrated that nutritional disturbances are implicated in the restriction of the growth under salinity stress [30–32]. Our molecular results showed that the difference in the AKT1 expression was not so great between the two accessions (Fig. 4), even if AKT1 is considered as a major contributor to K+ uptake from the soil solution [12,13,17]. This result is reminiscent of previous reports advancing that AKT1 is not regulated by changes in the K+ availability [12,33]. This suggests that K+ uptake is controlled at a different level or through the regulation of other(s) transporter(s). In contrast, a NOK2 specific up-regulation was observed for both the AKT2 and SKOR K+ channel genes at high K+ concentration (2.5 mM). This was observed for SKOR in the roots, and for AKT2 in the shoot. Indeed, these two K+ channels are involved in long distance transport of potassium, controlling the K+ loading into the xylem (SKOR) or into the phloem (AKT2) [18,19,34]. Over-expression of these two K+ channels might facilitate the translocation of K+ from the roots to the transpiring mature leaves (SKOR) and then the K+ circulation from the old leaves to the young ones (AKT2). This would contribute to raise the K+ content to high levels in shoots tissues, which characterizes NOK2 as compared to Columbia-0.

Fig. 4

Semiquantitative RT-PCR analysis of NHX1, SOS1, AKT1, AKT2 and SKOR gene expression in NOK2 and Columbia-0 (Col) plants submitted to combined effects of increasing K+ concentration in the culture medium and applying or not a 50 mM NaCl treatment. The 0.1, 0.625 and 2.5 mM K+ and 0 or 50 mM NaCl treatments were applied to 23 day-old individual plants and lasted 17 days. Shoots and roots were analysed separately. Amplification conditions were as described in “Materials and Methods”.

The cause behind the higher salt tolerance of NOK2 in comparison to Columbia-0 was not found to derive from NOK2's greater ability to limit Na+ absorption by roots, since the net Na+ uptake was similar in the two accessions. The leaf Na+ content was however much higher in Columbia-0 than in NOK2 (Fig. 3). This could be the consequence of a lower expression of the SOS1 Na+/H+ antiporter in Columbia-0 shoots compared to NOK2 ones (Fig. 4). Indeed, SOS1 controls long distance Na+ translocation from root to shoot in Arabidopsis [26] and over-expression of SOS1 increases tolerance to NaCl stress [35]. However, SOS1 over-expression was probably not the main factor responsible for the reduction in leaf Na+ accumulation observed in NOK2 as compared to Columbia-0. The reduced Na+ content in NOK2 leaves was more likely a consequence of Na+ dilution in the larger leaf biomass in this accession. Indeed, NOK2 leaves accumulated more than twice less sodium than Columbia-0 ones and, in the same time, NOK2 plants were two and three times bigger than Columbia-0 ones (Figs. 1, 3). The observed dehydration of Columbia-0 leaves that is concomitant with Na+ accumulation (Figs. 2, 3) suggests that Na+ ions transported to these organs were not correctly compartmentalized in leaf cells. In contrast, the observation that Na+ accumulation was correlated with leaf succulence in NOK2 (Figs. 2, 3) suggested that Na+ ions imported in leaves participated in retaining water in leaf cells. This could be related to the fact that NHX1 was over-expressed in response to salt to a higher level in NOK2 than in Columbia-0 (Fig. 4). NHX1 is indeed responsible for compartmentalizing Na+ into the vacuole, which participates in maintaining cellular integrity in plants challenged by salt, and attenuates the salt sensitivity in Arabidopsis [22,36]. A greater Na+ storage in the vacuole could enable a greater increase in leaf hydration upon salt treatment in NOK2 plants, while a defect in this function would cause leaf dehydration and necrosis in salt-treated Columbia-0 plants, as it has been proposed for other glycophytes [37–41].

In summary, our results evidence differences in K+ and Na+ transports between NOK2 and Columbia-0, which could explain the difference in salt tolerance between the two accessions. NOK2 appears to display a greater cellular and tissular tolerance. This is evidenced by an increase in the water content, leaf thickness and ultimately growth, which discriminates NOK2 from Columbia-0. These phenotypic observations can be correlated with a greater transcript accumulation of the NHX1 tonoplastic Na+/H+ antiporter gene that would suggest that NOK2 efficiently compartmentalizes Na+ in its leaf cell vacuoles. However, the main characteristic discriminating NOK2 from Columbia-0 is its superior ability to take up K+ from the culture medium in the presence of NaCl. The molecular bases for this trait are still unknown, but the two K+ channels controlling long distance K+ transport in the plant (SKOR and AKT2) can be proposed to be candidates for explaining the NOK2 higher performances. Our results enlighten the usefulness of considering NOK2 as a crucial accession for further analysing K+ nutrition and K+ vs. Na+ transport at the molecular level.

Acknowledgements

This work was supported by a grant from Tunisian–French, CMCU (network 02F/924).


References

[1] K. Mengel; E.A. Kirkby Principles of Plant Nutrition, Kluwer Academic Publisher, 1982 (p. 849) (ISBN: 978-1-4020-0008-9)

[2] D. Schachtman; W. Liu Molecular pieces to the puzzle of the interaction between potassium and sodium uptake in plants, Trends Plant Sci., Volume 4 (1999), pp. 281-287

[3] M. Tester; R. Davenport Na+ tolerance and Na+ transport in higher plants, Ann. Bot., Volume 91 (2003), pp. 503-527

[4] M.P. Apse; E. Blumwald Na+ transport in plants, FEBS Lett., Volume 581 (2007), pp. 2247-2254

[5] T.J. Flowers; M.A. Hajibagheri Salinity tolerance in Hordeum vulgare: Ion concentrations in root cells of cultivars differing in salt tolerance, Plant Soil, Volume 231 (2001), pp. 1-9

[6] D.E. Carden; D.J. Walker; T.J. Flowers; A.J. Miller Single-cell measurements of the contributions of cytosolic Na+ and K+ to salt tolerance, Plant Physiol., Volume 131 (2003), pp. 676-683

[7] T.A. Cuin; A.J. Miller; S.A. Laurie; R.A. Leigh Potassium activities in cell compartments of salt-grown barley leaves, J. Exp. Bot., Volume 54 (2003), pp. 657-661

[8] D. Golldack; F. Quigley; C.B. Michalowski; U.R. Kamasani; H.J. Bohnert Salinity stress-tolerant and -sensitive rice (Oryza sativa L.) regulate AKT1-type potassium channel transcripts differently, Plant Mol. Biol., Volume 51 (2003), pp. 71-81

[9] Y.H. Peng; Y.F. Zhu; Y.Q. Mao; S.W. Wang; W.A. Su; Z.C. Tang Alkali grass resists salt stress through high [K+] and an endodermis barrier to Na+, J. Exp. Bot., Volume 55 (2004), pp. 939-949

[10] N. Labidi; M. Lachaâl; F. Chibani; C. Grignon; M. Hajji Variability of the response to NaCl of eight ecotypes of Arabidopsis thaliana, J. Plant Nutr., Volume 25 (2002), pp. 2627-2638

[11] Z. Qi; E.P. Spalding Protection of plasma membrane K+ transport by the salt overly sensitive1 Na+–H+ antiporter during salinity stress, Plant Physiol., Volume 136 (2004), pp. 2548-2555

[12] R.E. Hirsch; B.D. Lewis; E.P. Spalding; M.R. Sussman A role for the AKT1 potassium channel in plant nutrition, Science, Volume 280 (1998), pp. 918-921

[13] E.P. Spalding; R.E. Hirsch; D.R. Lewis; Z. Qi; M.R. Sussman; B.D. Lewis Potassium uptake supporting plant growth in the absence of AKT1 channel activity: Inhibition by ammonium and stimulation by sodium, J. Gen. Physiol., Volume 113 (1999), pp. 909-918

[14] M.R. Broadley; A.J. Escobar-Gutierrez; H.C. Bowen; N.J. Willey; P.J. White Influx and accumulation of Cs+ by the akt1 mutant of Arabidopsis thaliana (L.) Heynh. lacking a dominant K+ transport system, J. Exp. Bot., Volume 52 (2001), pp. 839-844

[15] S. Rigas; G. Debrosses; K. Haralampidis; F. Vicente-Agullo; K. Feldmann et al. Trh1 encodes a potassium transporter required for tip growth in Arabidopsis root hairs, Plant Cell, Volume 13 (2001), pp. 139-151

[16] E.J. Kim; J.M. Kwak; N. Uozumi; J.I. Schroeder AtKUP1: An Arabidopsis gene encoding high-affinity potassium transport activity, Plant Cell, Volume 10 (1998), pp. 51-62

[17] M. Gierth; P. Mäser; J.I. Schroeder The potassium transporter AtHAK5 functions in K+ deprivation-induced high-affinity K+ uptake and AKT1 K+ channel contribution to K+ uptake kinetics in Arabidopsis roots, Plant Physiol., Volume 137 (2005), pp. 105-114

[18] F. Gaymard; G. Pilot; B. Lacombe; D. Bouchez; D. Bruneau; J. Boucherez; N. Michaux-Ferriere; J.-B. Thibaud; H. Sentenac Identification and disruption of a plant shaker-like outward channel involved in K+ release into the xylem sap, Cell, Volume 94 (1998), pp. 647-655

[19] B. Lacombe; G. Pilot; E. Michard; F. Gaymard; H. Sentenac; J.-B. Thibaud A Shaker-like K+ channel with weak rectification is expressed in both source and sink phloem tissues of Arabidopsis, Plant Cell, Volume 12 (2000), pp. 37-51

[20] H. Harada; R.A. Leigh Genetic mapping of natural variation in potassium concentrations in shoots of Arabidopsis thaliana, J. Exp. Bot., Volume 57 (2006) no. 4, pp. 953-960

[21] H.X. Zhang; E. Blumwald Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit, Nat. Biotechnol., Volume 19 (2001), pp. 765-768

[22] M.P. Apse; G.S. Aharon; W.A. Snedden; E. Blumwald Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis, Science, Volume 285 (1999), pp. 1256-1258

[23] H.X. Zhang; J. Hodson; J.P. Williams; E. Blumwald Engineering salt tolerant Brassica plants: Characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation, Proc. Natl. Acad. Sci. USA, Volume 98 (2001), pp. 12832-12836

[24] A. Rus; B-ha Lee; A. Muñoz-Mayor; A. Sharkhuu; K. Miura; J.-K. Zhu; R.A. Bressan; P.M. Hasegawa AtHKT1 facilitates Na+ homeostasis and K+ nutrition in planta, Plant Physiol., Volume 136 (2004), pp. 1-12

[25] L.Y. Shi; H.Q. Li; X.P. Pan; G.J. Wu; M.R. Li Improvement of Torenia fournieri salinity tolerance by expression of Arabidopsis AtNHX5, Funct. Plant Biol., Volume 35 (2008), pp. 185-192

[26] H.Z. Shi; F.J. Quintero; J.M. Pardo; J.K. Zhu The putative plasma membrane Na+/H+ antiporter SOS1 controls long-distance Na+ transport in plants, Plant Cell, Volume 4 (2002), pp. 465-477

[27] A.P. Gay; B. Hauck Acclimation of Lolium temulentum to enhanced carbon dioxide concentration, J. Exp. Bot., Volume 45 (1994), pp. 1133-1141

[28] M.G. Pitman Whole plants (A. Baker; J.L. Hall, eds.), Solute Transport in Plant Cells and Tissues, Longman Scientific and Technical, Harlow, Essex, 1988, pp. 346-385

[29] K. Liu; S. Xu; W. Xuan; T. Ling; Z. Cao; B. Huang; Y. Sun; L. Fang; Z. Liu; N. Zhao; W. Shen Carbon monoxide counteracts the inhibition of seed germination and alleviates oxidative damage caused by salt stress in Oryza sativa, Plant Science, Volume 172 (2007), pp. 544-555

[30] D. Messedi; N. Labidi; C. Grignon; C. Abdelly Limits imposed by salt to the growth of the halophyte Sesuvium portulacastrum, J. Plant Nutr. Soil Sci., Volume 167 (2004), pp. 720-725

[31] H. Attia; N. Karray; R. Mokded; M. Lachaâl Salt-imposed restrictions on the uptake of macroelements by roots of Arabidopsis thaliana, Acta Physiol. Plant, Volume 30 (2008), pp. 723-727

[32] K. Ben Hamed; D. Messedi; A. Ranieri; C. Abdelly Diversity in the response of two potential halophytes (Batis maitima and Crithmum maritimum) to salt stress (Chedly Abdelly; Muhamed Ashraf; Munir Ozturk; Claude Grignon, eds.), Biosaline Agriculture and High Salinity Tolerance, Birkhaüser Verlag AG, 2008, pp. 71-80

[33] F.J.M. Maathuis; V. Filatov; P. Herzyk; C. Krijger; B. Axelsen; S. Chen; B.J. Green; Y. Li; K.L. Madagan; R. Sanchez-Fernandez et al. Transcriptome analysis of root transporters reveals participation of multiple gene families in the response to cation stress, Plant J., Volume 35 (2003), pp. 675-692

[34] R. Deeken; C. Sanders; P. Ache; R. Hedrich Developmental and light-dependent regulation of a phloem-localised K+ channel of Arabidopsis thaliana, Plant J., Volume 23 (2000), pp. 285-290

[35] H. Shi; B.H. Lee; S.J. Wu; J.K. Zhu Overexpression of a plasma membrane Na+/H+ antiporter gene improves salt tolerance in Arabidopsis thaliana, Nat. Biotechnol., Volume 21 (2003), pp. 81-85

[36] F.J. Quintero; M.R. Blatt; J.M. Pardo Functional conservation between yeast and plant endosomal Na+/H+ antiporters, FEBS Lett., Volume 471 (2000), pp. 224-228

[37] J.J. Oertli Extra cellular salt accumulation, a possible mechanism of salt injury in plants, Agrochimica, Volume 12 (1968), pp. 461-469

[38] R. Munns; J.B. Passioura Effect of prolonged exposure to NaCl on the osmotic pressure of leaf xylem sap from intact, transpiring Barley plants, Aust. J. Plant Physiol., Volume 11 (1984) no. 6, pp. 497-507

[39] R.W. Kingsbury; E. Epstein Salt sensitivity in wheat. A case for specific ion toxicity, Plant Physiol., Volume 80 (1986), pp. 651-654

[40] T.J. Flowers; M.A. Hajibagheri; A.R. Yeo Ion accumulation in the cell walls of rice plants growing under saline condition: Evidence for the Oertli hypothesis, Plant Cell Environ., Volume 14 (1991), pp. 319-325

[41] M. Speer; W.M. Kaiser Ion relations of symplastic and apoplastic space in leaves from Spinacia oleracea L. and Pisum sativum L. under salinity, Plant Physiol., Volume 97 (1991), pp. 990-997


Comments - Policy