\makeatletter
\@ifundefined{HCode}
{\documentclass[screen,CRCHIM,Unicode,biblatex]{cedram}
\addbibresource{crchim20250744.bib}
\newenvironment{noXML}{}{}
\def\tsup#1{$^{{#1}}$}
\def\tsub#1{$_{{#1}}$}
\def\ndash{\text{--}}
\usepackage[T1]{fontenc}
\def\thead{\noalign{\relax}\hline}
\def\tbody{\noalign{\relax}\hline}
\def\endthead{\noalign{\relax}\hline}
\def\tabnote#1{\vskip4pt\parbox{.98\linewidth}{#1}}
\RequirePackage{etoolbox}
\def\jobid{crchim20250744}
%\graphicspath{{/tmp/\jobid_figs/web/}}
\graphicspath{{./figures/}}
\newcounter{runlevel}
\let\MakeYrStrItalic\relax
\csdef{Seqnsplit}{\\}
\def\refinput#1{}
\def\back#1{}
\def\botline{\\\hline}
\def\dollar{\$}
\def\ubreak{\break}
\def\og{\guillemotleft}
\def\fg{\guillemotright}
\def\mn{\phantom{$-$}}
\def\0{\phantom{0}}
\def\figType#1{}
\usepackage{multirow} 
\def\nrow#1{\@tempcnta #1\relax%
\advance\@tempcnta by 1\relax%
\xdef\lenrow{\the\@tempcnta}}
\def\morerows#1#2{\nrow{#1}\multirow{\lenrow}{*}{#2}}
\usepackage{hyperref}
\makeatletter
\g@addto@macro{\UrlBreaks}{\UrlOrds}
\gappto{\UrlBreaks}{\UrlOrds}
\DOI{10.5802/crchim.426}
\datereceived{2025-09-19}
\daterevised{2025-10-06}
\dateaccepted{2025-10-08}
\ItHasTeXPublished
}
{\documentclass[crchim]{article}
\usepackage[T1]{fontenc}
\def\CDRdoi{10.5802/crchim.426}
\let\refinput\input
\let\ubreak\relax
\makeatletter
\def\CDRsupplementaryTwotypes#1#2{}
\let\splittabular\relax
}
\makeatother

\usepackage{upgreek}

\begin{document}

\begin{noXML}

\CDRsetmeta{articletype}{research-article}

\title{2-Deoxystreptamine as a platform to design original inhibitors
of oncogenic miRNA biogenesis}

\alttitle{La 2-d\'{e}soxystreptamine en tant que plateforme pour
concevoir de nouveaux inhibiteurs de la biogen\`{e}se de miARN
oncog\`{e}nes}

\author{\firstname{Thi Phuong Anh} \lastname{Tran}}
\address{Universit\'{e} C\^{o}te d'Azur, CNRS, Institut de Chimie de
Nice (ICN), 28 avenue Valrose, 06100 Nice, France}

\author{\firstname{Nadia} \lastname{Patino}} 
\addressSameAs{1}{Universit\'{e} C\^{o}te d'Azur, CNRS, Institut de Chimie de
Nice (ICN), 28 avenue Valrose, 06100 Nice, France}

\author{\firstname{Audrey} \lastname{Di Giorgio}} 
\addressSameAs{1}{Universit\'{e} C\^{o}te d'Azur, CNRS, Institut de Chimie de
Nice (ICN), 28 avenue Valrose, 06100 Nice, France}

\author{\firstname{Maria} \lastname{Duca}\CDRorcid{0000-0002-2666-6180}\IsCorresp}
\addressSameAs{1}{Universit\'{e} C\^{o}te d'Azur, CNRS, Institut de Chimie de
Nice (ICN), 28 avenue Valrose, 06100 Nice, France}
\email[M. Duca]{maria.duca@univ-cotedazur.fr}

\shortrunauthors

\keywords{\kwd{RNA ligands}\kwd{RNA 
targeting}\kwd{MicroRNAs}\kwd{2-Deoxystreptamine}\kwd{Carbamates}}

\altkeywords{\kwd{Ligands d'ARN}\kwd{Ciblage 
d'ARN}\kwd{MicroARN}\kwd{2-D\'{e}soxystreptamine}\kwd{Carbamates}}


\begin{abstract}
MicroRNAs are small non-coding RNAs playing a key role in the
regulation of gene expression. The overexpression of microRNAs in
cancer has been recognized not only as a specific biomarker but also as
a potential target to inhibit cancer cell proliferation or increase
their sensitivity to chemotherapy. In this work, we present
2-deoxystreptamine as an ideal platform for the design and synthesis of
selective RNA binders directed against the biogenesis of an oncogenic
microRNA: miR-372. The developed compounds have been designed to bind
to the structured precursor of this microRNA and block its processing
toward the mature miRNA (miR-372). The performed affinity and
selectivity studies revealed that one of the prepared binders is
particularly selective for the targeted miRNAs and shows a very
promising activity in inhibiting the production of the mature miRNAs.
\vspace*{-4pt}
\end{abstract}

\begin{altabstract}
Les microARN sont de petits ARN non-codants qui jouent un r\^{o}le
cl\'{e} dans la r\'{e}gulation de l'expression des g\`{e}nes. Leur
surexpression dans le cancer a \'{e}t\'{e} reconnue non seulement comme
\'{e}tant un biomarqueur sp\'{e}cifique, mais \'{e}galement comme une
cible potentielle afin d'inhiber la prolif\'{e}ration des cellules
canc\'{e}reuses ou d'accro\^{i}tre leur sensibilit\'{e} \`{a} la
chimioth\'{e}rapie. Dans ce travail, nous pr\'{e}sentons la
2-d\'{e}soxystreptamine comme une plateforme id\'{e}ale pour la
conception et la synth\`{e}se de ligands s\'{e}lectifs de l'ARN
dirig\'{e}s contre la biogen\`{e}se d'un microARN oncog\`{e}ne : le
miR-372. Les compos\'{e}s d\'{e}velopp\'{e}s ont \'{e}t\'{e} con\c{c}us
pour se lier au pr\'{e}curseur structur\'{e} de ce microARN et bloquer
sa maturation vers le miR-372. Les \'{e}tudes d'affinit\'{e} et de
s\'{e}lectivit\'{e} r\'{e}alis\'{e}es ont r\'{e}v\'{e}l\'{e} que l'un
des ligands pr\'{e}par\'{e}s pr\'{e}sente une s\'{e}lectivit\'{e}
particuli\`{e}rement marqu\'{e}e pour le microARN cibl\'{e} et montre
une activit\'{e} tr\`{e}s prometteuse dans l'inhibition de la
production du microARN mature.
\end{altabstract}

\editornote{Article submitted by invitation}
\alteditornote{Article soumis sur invitation}

\maketitle

\vspace*{-1.5pt}

\twocolumngrid

\end{noXML}

\let\rmmu\upmu

\section{Introduction}

Targeting RNA using synthetic small molecules has become an important
field of medicinal chemistry~\cite{1}. Indeed, the targeting of
{biologically} relevant RNAs is {an interesting} approach for the
discovery of innovative therapies because of the essential role that
RNA plays in all major biological processes~\cite{2}. {Noteworthy, RNA
bears a tridimensional structure associating single-stranded and
double-stranded regions and leading to the formation of stem-loop
structures containing internal loops and bulges that create ideal
binding sites for small-molecule ligands due to the distortion of the
RNA double helix}~\cite{3}. A number of RNA binders has been reported
in the literature during the last twenty years against viral, bacterial
and oncogenic RNAs~\cite{4}. Furthermore, drugs acting as RNA binders
are already on the market, such as the antibiotic aminoglycosides or
mRNA splicing modulators, such as risdiplam~\cite{5}. However,
{methods} to rationally design ligands specific to a particular RNA
structure remain underdeveloped because of a lack of knowledge about
the tridimensional structure of most RNA targets as well as about the
interactions formed by the reported ligands~\cite{1}. 

\begin{figure*}
\includegraphics{fig01}
\vspace*{-1pt}
\caption{\label{fig1}(A) General process of pre-miRNA cleavage by Dicer
to produce the mature miRNA. When the miRNA is oncogenic, its
production induces the proliferation of cancer cells, and the pre-miRNA
represents a potential target for small molecules to block cancer cell
proliferation. (B) Chemical structure of a previously identified
pre-miR-372 binder based on 2-DOS conjugated via a triazole linker to a
heteroaromatic motif to form \textbf{DOS-D}$_{\textbf{3}}$. (C) General
chemical structure of the 2-DOS conjugates prepared in this study.}
\vspace*{-2pt}
\end{figure*}


During the last years, our group has focused on the targeting of
{non-coding} RNAs, such as microRNAs (miRNAs or miRs). {These} small
non-coding RNAs are responsible for the regulation of gene
expression~\cite{6}. They are produced in the cell starting from two
precursors: primary miRNAs (pri-miRNAs) followed by precursor miRNAs
(pre-miRNAs) upon processing by intracellular ribonucleases called
Drosha and Dicer, respectively (Figure~\ref{fig1}A). These precursors are
stem-loop--structured RNAs and have been reported as targets for small
molecules. In this context, we reported various series of compounds
whose synthesis was performed using a focused design~\cite{7,8,9,10,11,12,13,14} based
on the conjugation of various RNA-binding domains that act
cooperatively to bind the RNA target with both affinity and
selectivity. More specifically, several binding domains such as
aminoglycosides, heteroaromatic compounds, and amino
acids~\cite{10,11,13,14} were combined to synthesize ligands directed
against the production of miR-372, an oncogenic miRNA involved in
various cancers~\cite{15,16}, such as gastric cancer. This work allowed
us to develop optimized compounds with a specific antiproliferative
activity in gastric adenocarcinoma cells overexpressing miR-372. The
mechanism of this inhibition was clearly identified as resulting from
the binding to pre-miR-372 and the inhibition of Dicer processing
leading to mature miRNA. Among these ligands, there were a series of
conjugates containing the 2-{deoxystreptamine} (2-DOS) core linked to
various heteroaromatic compounds via a triazole linker~\cite{17}. This
led us to the discovery of compound
\textbf{DOS-D}$_{\textbf{3}}$ (Figure~\ref{fig1}B), which showed a
low micromolar affinity for pre-miR-372 as well as a low micromolar
IC$_{50}$ for the inhibition of Dicer processing. This
compound is composed of a 2-DOS structure, present in most of the
aminoglycoside antibiotics that act by binding to prokaryotic ribosomal
RNA thus impairing protein synthesis in bacteria, coupled via a
triazole linker to an artificial nucleobase called D$_{3}$.
While 2-DOS is known to strongly interact with RNA but lacks
selectivity, the heteroaromatic moiety D$_{3}$ is known to
selectively interact with A${\bullet}$U base pairs via the formation of
specific hydrogen bonds to form a base triplet~\cite{18}. Thus,
derivatives combining 2-DOS and more selective substructures (such as
D$_{3}$ for example) have the advantage of bearing more
favorable physicochemical properties than their aminoglycoside
counterpart while maintaining a similar affinity for RNA. In this work,
we decided to explore the carbamate linker as a replacement for the
triazole one to modify the properties of the compounds (Figure~\ref{fig1}C).
Indeed, while both triazole and carbamate are commonly employed in
medicinal chemistry, the carbamate linker is more flexible and could
improve affinity and binding properties~\cite{19}. Carbamates can serve
as both hydrogen-bond donors and acceptors and, since they are
geometrically and electronically closer to amides than triazoles, they
can better mimic peptide-like motifs, peptides being the RNA binders
chosen by Nature. 


We thus prepared a series of nine derivatives where 2-DOS was
conjugated {with} a carbamate linker to aromatic and heteroaromatic
compounds. These new derivatives have been studied against our primary
target, pre-miR-372, but also against other miRNAs that could represent
potential targets or competitors. The study of the affinity,
selectivity and inhibition activity for the processing of these miRNAs
revealed a promising selectivity profile for some compounds that could
be exploited for future intracellular studies.

\begin{scheme*}
\vspace*{-1pt}
\includegraphics{sc01}
\vspace*{5pt}
\caption{\label{sch1}Synthesis of new carbamate derivatives of 2-DOS
\textbf{4a--i}.}
\vspace*{-2pt}
\end{scheme*}

\vspace*{-1pt}

\section{Results and discussion}

\subsection{Synthesis of 2-deoxystreptamine derivatives}
2-DOS represents an ideal platform for the development of RNA binders
since it bears two \textit{cis}-amino groups recognized as very
important for RNA binding and hydroxyl groups that can be
functionalized~\cite{20,21}. We thus decided to substitute one of the
hydroxyl groups with various aromatic and heteroaromatic substituents
via the formation of a \mbox{carbamate} linker. {Carbamates show many
advantages, such as the ability to permeate the cell membrane as well
as a particular chemical stability. For these reasons, carbamates have
been used in the design of various drugs, such as ${\upbeta}$- and}
{${\upgamma}$}-secretase inhibitors, carbamate-based Hepatitis C virus
(HCV) therapeutics or cysteine-protease inhibitors~\cite{19}. To
prepare new conjugates with 2-DOS, we chose to conjugate various
aromatic and heteroaromatic compounds (R in Figure~\ref{fig1}B). First, we
chose phenyl substituents containing or not fluorine atom(s) because
this kind of substituent could interact with RNA by forming hydrophobic
interactions or {through} unusual hydrogen bonds mediated by the
fluorine atoms. Then, we chose heteroaromatic compounds such as
imidazole, benzimidazole, pyridine, and the previously employed D$_{3}$
nucleobase
{{[}}\textit{N}-(3-(1-(3-aminopropyl)-1\textit{H}-imidazol-4-yl)phenyl)benzamide{{]}}. 
{To obtain a novel series of ligands with high RNA binding affinity and
miRNA inhibitory activity, we thus employed commercially available
substrates as well as starting materials prepared using straightforward
synthetic pathways.} To synthesize the carbamate compounds, we decided
to start from the previously prepared protected racemic compound
\textbf{1}~\cite{17} and to use two approaches (Scheme~\ref{sch1}):
{(i)} preparation of the activated carbonate \textbf{2} followed by
amine substitution leading to compounds \textbf{3a--f}, and {(ii)}
reaction of the free alcohol of \textbf{1} with various isocyanates
leading to compounds \textbf{3g--i}.


Following the first strategy, compound \textbf{1} was converted into
its corresponding activated carbonate \textbf{2} {in the presence of}
4-nitrophenyl chloroformate in CH$_{2}$Cl$_{2}$.
Compound \textbf{2}, {obtained in 93\% yield,} was then coupled with
suitable (hetero)aromatic compounds bearing amine groups in order to
form the desired carbamate derivatives. We selected five commercially
available {amines} for the synthesis of compounds \textbf{3a--e} and an
artificial nucleobase that we had previously prepared for the synthesis
of neomycin and 2-DOS derivatives, {e.g.}, the
\textit{N}-(3-(1-(3-aminopropyl)-1\textit{H}-imidazol-4-yl)phenyl)benzamide~\cite{22} 
also called D$_{3}$ for the preparation of compound \textbf{3f} and to
achieve structural diversity of synthesized ligands (Figure~S1,
Supporting Information for the chemical structures of amine
derivatives). The {reaction} of the amines with carbonate \textbf{2}
was carried out in the presence of Et$_{3}$N in
CH$_{2}$Cl$_{2}$ at {50~\textdegree C leading to
the} protected carbamate derivatives \textbf{3a--f} in 33--88\% yields.
{Removal of the Boc and acetal protecting groups of compounds}
{\textbf{3a--f}} {was performed} in one step under acidic conditions
(TFA in a mixture of CH$_{2}$Cl$_{2}$/water 2:1)
and in the presence of tripropylsilane (5\%) as a scavenger. {The}
final compounds \textbf{4a--f} were obtained in 22--67\% yields. 

Concomitantly to the preparation of carbamate derivatives
\textbf{4a--f}, {we also decided to prepare new conjugates upon
reaction of commercially available isocyanates with compound}
{\textbf{1}}{.} {As illustrated in Scheme~\ref{sch1},} treatment of three
isocyanates, whose chemical {structures are} illustrated in Figure~S2,
with protected 2-DOS \textbf{1} in the presence of Et$_{3}$N at
{50~\textdegree C}, led to the desired carbamates \textbf{3g--i} in
56--90\% yields. {The final deprotection of these conjugates using} TFA
and TIS (5\%) in a mixture of CH$_{2}$Cl$_{2}$/H$_{2}$O (2:1) {allowed
the obtention} of the final compounds \textbf{4g--i}, which were
isolated in 52--100\% yield after purifications using
semi{-}preparative HPLC. All conjugates were fully characterized by
NMR, HRMS,\break and HPLC.

\subsection{Evaluation of the affinity and inhibition activity of the
synthesized 2-DOS conjugates}
Once the compounds synthesized and
characterized, we evaluated their affinity for pre-miR-372 but also for
other microRNAs to assess the extent of selectivity that could be
reached by {these} compounds. For this, pre-miR-17 as well as
pre-miR18a, pre-miR-148a, and pre-miR-210 {were chosen}. The
corresponding miRNAs are overexpressed in {different types of} cancers
thus representing interesting RNAs to assess selectivity but also as
potential targets. The evaluation of the affinity was performed using
{established assays where the target RNA is 5$'$-labeled with a
fluorophore} (fluoresceine) and incubated with increasing
concentrations of the synthesized compounds. If a compound binds to the
RNA target, the environment of the fluorophore changes and induces a
dose-dependent variation in fluorescence. This allows the measurement
of dissociation constants (${K}_{\mathrm{D}}$) for all compounds against the
five chosen pre-miRNAs. The results {reported} in Table~\ref{tab1} 
demonstrated
that among all tested compounds, only three displayed an affinity for
the pre-miRNAs studied: compounds \textbf{4c}, \textbf{4f}, and
\textbf{4h}. Compounds \textbf{4c} and \textbf{4h} showed affinity only
for one pre-miRNA each, i.e., pre-miR-210 for \textbf{4c} ($K_{\mathrm{D}} =
42.3~\rmmu \mathrm{M}$) and pre-miR-372 for \textbf{4h} ($K_{\mathrm{D}}$ of
38.4 $\rmmu\mathrm{M}$). These results, although moderate, suggest that
these compounds could be further studied to optimize them in order to
obtain selective compounds for one targeted RNA structure. {Compound}
{\textbf{4f}} {strongly} binds to both pre-miR-372 ($K_{\mathrm{D}}$ of 
2.36~$\rmmu\mathrm{M}$) and pre-miR-17 ($K_{\mathrm{D}} = 1.88~\rmmu\mathrm{M}$),
while the affinity decreases at least ten times when tested on other
pre-miRNAs. To further confirm the selectivity of compound \textbf{4f},
we tested it in competition with other nucleic acids, i.e., a large
excess (100 {equiv}) of tRNA and DNA, and the obtained results showed
that {\textbf{4f}} maintains its affinity for pre-miR-372 in both
cases (data not shown). \looseness=-1

\begin{figure*}
\vspace*{1pt}
\includegraphics{fig02}
\vspace*{2pt}
\caption{\label{fig2}(A) Dissociation constants curves for compound
\textbf{4f} against pre-miR-372 (full black squares) and pre-miR-17
(empty grey squares) with the associated $K_{\mathrm{D}}$ values. (B)
Dissociation constants curves for compound \textbf{DOS-D}$_{\textbf{3}}$ 
against pre-miR-372 (full black circles) and pre-miR-17 (empty grey circles)
with the associated $K_{\mathrm{D}}$ values. (C) Inhibition curves for the
processing of pre-miR-372 (full black squares) and pre-miR-17 (empty
grey squares) by Dicer in the presence of compound \textbf{4f} and the
associated IC$_{50}$ values. (D) Inhibition curves for the processing of
pre-miR-372 (full black circles) and pre-miR-17 (empty grey circles) by
Dicer in the presence of compound \textbf{DOS-D}$_{\textbf{3}}$ and the
associated IC$_{50}$ values.}
\vspace*{4pt}
\end{figure*}

\begin{table*}
\caption{\label{tab1} Dissociation constants ($K_{\mathrm{D}}$,
$\rmmu\mathrm{M}$) for synthesized compounds \textbf{4a--i} and for
reference \textbf{DOS-D}$_{\textbf{3}}$ against pre-miR-372,
-17, -18a, -148a, and -210}
\tabcolsep4pt
\begin{tabular}{cccccc}
\thead
{ID} & ${K}_{\mathrm{D}}$ {(pre-miR-372)} & ${K}_{\mathrm{D}}$ 
{(pre-miR-17)} & ${K}_{\mathrm{D}}$ {(pre-miR-18a)} & 
${K}_{\mathrm{D}}$ {(pre-miR-148a)} & ${K}_{\mathrm{D}}$ {(pre-miR-210)} \\
\endthead
\textbf{4a} & No binding & {\textgreater}50 & No binding & No binding & No binding \\
\textbf{4b} & {\textgreater}50 & {\textgreater}50 & No binding & No binding & No binding \\
\textbf{4c} & No binding & {\textgreater}50 & No binding & No binding & 42.3 ${\pm}$ 7.5 \\
\textbf{4d} & No binding & {\textgreater}50 & No binding & No binding & No binding \\
\textbf{4e} & No binding & No binding & No binding & No binding & No binding \\
{\textbf{4f}} & {\textbf{2.36 ${\pm}$ 0.32}} & {\textbf{1.88 ${\pm}$ 0.22}} & {\textbf{20.2 ${\pm}$ 1.85}} & {\textbf{33.5 ${\pm}$ 0.35}} & {\textbf{35.7 ${\pm}$ 0.42}} \\
\textbf{4g} & No binding & No binding & No binding & No binding & No binding \\
\textbf{4h} & 38.4 ${\pm}$ 11 & No binding & No binding & No binding & No binding \\
\textbf{4i} & {\textgreater}50 & {\textgreater}50 & No binding & No binding & No binding \\
\textbf{DOS-D}$_{\textbf{3}}$ & 2.52 ${\pm}$ 0.58 & 0.880 ${\pm}$ 0.075 &  &  & 
\botline
\end{tabular}
\tabnote{Binding studies were performed on 5$'$-FAM-pre-miR-372 in 20 mM
Tris-HCl buffer (pH 7.4), 12 mM NaCl, 2.5~mM MgCl$_{2}$, and 1 mM DTT.}
\end{table*}


Interestingly, compound \textbf{4f} exhibits the same affinity as the
previous hit of the triazole series \textbf{DOS-D}$_{\textbf{3}}$
(Figure~\ref{fig1}A) suggesting that the linker does not affect {the}
affinity. We thus wondered if the modification of the linker from
triazole to carbamate was affecting the inhibition activity. To assess
this parameter, we employed a FRET-based assay that we had previously
validated to measure the ability of a compound to block Dicer
processing by binding to a pre-miRNA. 


Compounds \textbf{4f} (Figure~\ref{fig2}A) and \textbf{DOS-D}$_{\textbf{3}}$
(Figure~\ref{fig2}B) exhibit similar affinity for both pre-miR-372 and
pre-miR-17. In contrast, compound \textbf{4f} shows a 11.3
$\rmmu\mathrm{M}$ IC$_{50}$ for the inhibition of pre-miR-372
processing but cannot inhibit Dicer processing of pre-miR-17
(Figure~\ref{fig2}C). Derivative \textbf{DOS-D}$_{\textbf{3}}$ can inhibit the
processing of pre-miR-372 and pre-miR-17 with similar IC$_{50}$s of
15.9 and 17.6 $\rmmu\mathrm{M}$, respectively (Figure~\ref{fig2}D). So,
while \textbf{DOS-D}$_{\textbf{3}}$ does not show selectivity between pre-miR-372
and pre-miR-17 in binding and inhibition activities, compound
\textbf{4f}, while binding both, inhibits only the processing of
pre-miR-372. This could be due to differences in the binding site that
could be much more favorable for inhibition in the case of pre-miR-372
than in pre-miR-17 and this {result further} supports the selectivity
of compound \textbf{4f} for the targeted miRNA. 

\subsection{Study of the binding site of compound \textbf{4f}}
{To gain a better understanding of} differences in the inhibition
activity between pre-miR-372 and -17 for compound \textbf{4f}, we
employed molecular docking and explored what could be the site of
interaction of {\textbf{4f}} on the two RNA structures. MC-Fold/MC-Sym,
a program allowing RNA-structure prediction, was previously employed
to predict the structural organization and the double-helix region of
{multiple} pre-miRNAs~\cite{23}. Here, we employed the pre-miR-372 and
pre-miR-17 {structures obtained} by integrating the MC-Fold/MC-Sym and
AutoDock programs~\cite{24}. The exploration of the binding site of
compound \textbf{4f} on pre-miR-372 showed that this compound likely
interacts with residues A11--G14 and U49--C51 where a G-bulge as well
as an internal G-loop open the duplex region offering a favorable
binding site (Figure~\ref{fig3}). Compared to our previous study about
the \textbf{DOS-D}$_{\textbf{3}}$ \mbox{compound,} the binding site has
changed. This highlights how minor changes in the chemical structure of
an RNA ligand unexpectedly modify its binding site, rendering
unpredictable which modifications should be performed to improve
binding. 


\begin{figure*}
\vspace*{2pt}
\includegraphics{fig03}
\vspace*{2pt}
\caption{\label{fig3}(A) Primary and secondary structures of pre-miR-372
RNA target. (B) Docking of compound \textbf{4f} with the pre-miR-372
hairpin loop performed using Autodock 4 in which the grid boxes were
fixed on the entire RNA sequence. (C) Chemical structure of compound
\textbf{4f} and detail of the binding pocket and interactions formed.}
\vspace*{3pt}
\end{figure*}


The results described above, however, support a selective binding to
{pre-miR-372}. While the binding site of \textbf{4f} on pre-miR-372 was
confirmed in all \mbox{binding} poses obtained after docking, we found many
possible binding sites in the case of pre-miR-17 binding. The one that
occurs most frequently is located in the internal loop CA/GUA located
in the lower-stem part of the pre-miRNA (Figure~S4). These results
suggest that binding to pre-miR-372 is much more efficient than to
pre-miR-17 in inhibiting Dicer processing, due to differences in the
binding site and interactions. 

\section{Conclusion}

In this work, we successfully synthesized a new series of 2-DOS
conjugates using a divergent synthetic {method} that led to nine new
compounds. Some of these compounds can bind to the desired target
pre-miR-372, the precursor of oncogenic miR-372, with low micromolar
affinities making them interesting compounds, especially compound
\textbf{4f}, able to inhibit Dicer processing of this pre-miRNA.
Interestingly, compound \textbf{4f} is also selective since the
comparison of its affinity with pre-miR-17, -18a, -148a, and -210
showed that {\textbf{4f}} binds to pre-miR372 and pre-miR-17 with
similar activities but not to the other pre-miRNAs. Furthermore,
compound \textbf{4f} showed a specific inhibition of pre-miR-372
processing while the other pre-miRNAs were not affected. Molecular
docking showed that the binding site of \textbf{4f} on the pre-miR-372
structure is much more favorable for inhibition than the one on
pre-miR-17 thus explaining the specificity observed in inhibition
activity. It is important to note that compound \textbf{4f} derives
from the conjugation of 2-DOS with an artificial nucleobase via a
carbamate linker and that we previously studied the same conjugate but
containing a triazole linker: compound \textbf{DOS-D}$_{\textbf{3}}$. Both
compounds show similar activity on pre-miR-372 but only \textbf{4f}
shows a specific inhibition activity. Furthermore, the modification
from a triazole to a carbamate linker induced a major change in the
binding site on the pre-miR-372 structure. This further supports an
observation that we made for many series of RNA ligands before: what
could be considered minor changes in the chemical structure of an RNA
binder induces major modifications in the binding site and eventual
biological activity. This represents one of the major limitations when
designing RNA binders since it hampers our ability to predict the
chemical modifications that should be introduced to improve binding
based on the structure of the target. The study presented here
contributes to a better understanding of the binding and inhibition
activity of this kind of 2-DOS derivatives and more generally to the
rules that govern RNA binding to small molecules.



\section{Experimental section}

\subsection{Chemistry}


{Reagents and solvents were purchased from Merck or Carlo Erba and used
without further purification. All reactions that involved air- or
moisture-sensitive reagents or intermediates were performed under an
argon atmosphere. Flash column chromatography was carried out on silica
gel (Merck; SDS 60 \AA{}, 40--63} ${\upmu}${M, VWR). Analytical TLC was
conducted on pre-coated silica gel plates (60F254; Merck) and compounds
were visualized by irradiation (}$\lambda = 254$~nm) or by staining
with ninhydrin. $^{1}${H and} $^{13}${C NMR
spectra were recorded on Bruker AC 200 and 500 MHz spectrometers.
Chemical shifts are reported in parts per million (ppm,} ${\delta}${)
referenced to the residual} $^{1}${H resonance of the
solvent (CDCl}$_{3}$~${\delta}$~{7.26; CD}$_{3}${OD} ${\delta}$ {3.31;
DMSO-}${{d}}_{6}~\delta~2.50$;
acetone-${{d}}_{6}~\delta~2.05$ ppm).
Splitting patterns are labeled as follows: s (singlet), d (doublet), t
(triplet), m (multiplet), and br s (broad singlet). Coupling constants
({\textit{J}}{) are listed in hertz (Hz). High resolution mass
spectrometry (HRMS) was carried out on an LTQ Orbitrap hybrid mass
spectrometer with an electrospray ionization probe (Thermo Fisher
Scientific, San Jose, CA) by direct infusion from a pump syringe, to
confirm the correct molar mass and high purity of the compounds. HPLC
analyses were performed using a Waters Arc HPLC pump coupled to a
Waters 2998 photodiode array detector and Waters
Cortex{\textregistered} C18+ column (50 ${\times}$ 4.6 mm, 2.7}
${\rmmu}${m). Analyses were run at room temperature by using a gradient
of CH}$_{3}${CN containing 0.1\% formic acid (eluent B) in water
containing 0.1\% formic acid (eluent A) at a flow rate of 1.5 mL/min.
The gradient} {{of elution}} employed was 5 to 40\% eluent B over 5
min and 40 to 100\% eluent B over 2 min.

1,3-Bis-\textit{N}-(\textit{tert}-butyloxycarbonyl)-5,6-\textit{O}-cyclohe\-xylidene-2-deoxystreptamine 
(\textbf{1}) was prepared following a previously published
procedure~\cite{17}.


\subsection{General protocol of carbamate synthesis starting from the
activated carbonate of \textbf{2} (General procedure A)}
To a stirred solution
of compound \textbf{2} (100 mg, 0.16~mmol) in CH$_{2}$Cl$_{2}$ (5 mL),
were added triethylamine (25~$\rmmu$L, 0.18 mmol, 1.1 {equiv})
and the appropriate amine (commercially available benzylamine,
3-fluorobenzylamine, 1-(3-aminopropyl)imidazole, 2-aminobenzimidazole,
3-aminopyridine and the prepared
\textit{N}-(3-(1-(3-aminopropyl-1\textit{H}-imidazol-4-yl)phenyl)benzamide 
(see below) (0.18 mmol, 1.1 {equiv}) at room temperature. After
stirring for {24 h} at rt or at {50~\textdegree C}, the reaction mixture
was evaporated under reduced pressure, and the crude residue was
purified by flash chromatography on a silica gel column. 

\subsection{General protocol of carbamate synthesis starting from
protected \textbf{1} (General procedure~B)}

To a solution of compound \textbf{1} (100 mg, 0.23 mmol) in
CH$_{2}$Cl$_{2}$ (5 mL), were added triethylamine 
(47.4~$\rmmu$L, 0.34 mmol, 1.5 {equiv}) and the appropriate
isocyanate (butyl isocyanate, 2,4-dichloro-1-(2-isocyanatoethyl)benzene
and 1-fluoro-4-(2-isocyanatoethyl)benzene, 0.34 mmol, 1.5 {equiv}).
After stirring for {24 h} at {50~\textdegree C}, the reaction was
concentrated in vacuo, and the residue was purified by silica gel
column chromatography.

\subsection{General procedure for {cleavage of the} Boc and acetal groups (General procedure C)}
To a solution of protected compounds \textbf{3a--i} in CH$_{2}$Cl$_{2}$
and H$_{2}$O (3:1), was added TFA (50 {equiv}). The reaction mixture
was stirred at rt overnight. Solvent and residues of TFA were then
removed under reduced pressure by co-evaporating twice with toluene.
Ether precipitation led to pure compounds as white solids (TFA salts). 

\subsection{\textit{N}-3-(1-(3-aminopropyl-1{\textit{H}}-imidazol-4-yl)phenyl)benzamide 
(D$_{3}$)} 
To a solution of the previously described
\textit{N}-(3-(1\textit{H}-imidazol-4-yl)phenyl)benzamide (250 mg, 
0.95~mmol) in dry THF (10 mL), were added sodium hydride (45.6 mg, 1.9 mmol,
2 {equiv}) and 3-(Boc-amino)propyl bromide (317 mg, 1.42 mmol, 1.4
{equiv}), and the reaction mixture was stirred overnight at
60~\textdegree C. After evaporation of the solvent, the crude residue
was dissolved in {EtOAc} and washed three times with
{H}$_{{2}}${O}. The organic phase was dried over reduced
pressure. The residue was then purified by flash chromatography on a
silica gel column using a mixture of CH$_{2}$Cl$_{2}$/MeOH 98:2 leading
to {the} desired protected compound as a light yellow solid. This
compound was then deprotected using TFA (61~$\rmmu$L, 0.79
mmol, 10 {equiv}) in CH$_{2}$Cl$_{2}$ (0.6~mL) at {rt} for {3 h}. After
evaporation of the solvent and removal of the residual TFA by
co-evaporation with toluene, the crude product was purified by flash
chromatography on a silica gel column using a mixture of
CH$_{2}$Cl$_{2}$/MeOH 9:1 leading to the desired protected compound as
a light yellow solid in 73\% yield (300~mg) over two steps.
${R}_{\mathrm{F}} = 0.20$ (CH$_{2}$Cl$_{2}$/MeOH 8:2); $^{1}$H
NMR (200~MHz, CD$_{3}$OD) ${\delta}$ (ppm): 8.10--7.90 (m, 3H),
7.80--7.70 (m, 2H), 7.65--7.50 (m, 5H), 7.40--7.30 (m, 1H), 4.20--4.10
(t, ${J} = 6.0$ Hz, 2H), 2.70--2.60 (m, 2H), 2.10--1.95 (m, 2H);
$^{13}$C NMR (50 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 161.5,
157.9, 148.3, 144.9, 140.2, 138.9, 136.1, 132.8, 129.6, 128.6, 121.9,
120.7, 118.3, 117.1, 45.6, 38.1, 34.7; MS (ESI) ${m/z} = 321.2$
{[}M${+}$H{]}$^{+}$ (theoretical \textit{m/z}~321.0).\looseness=1

\subsection{1,3-Bis-{\textit{N}}-({\textit{tert}}-butyloxycarbonyl)-5,6-\textit{O}-cyclohexylidene-2-deoxystreptamine-4-{\textit{O}}-{[}p-nitrophenyl{]} carbonate (\textbf{2})} 

To a solution of commercially available \textit{p}-nitrophenyl
chloroformate (980 mg, 4.86 mmol, 3.5 {equiv}) in CH$_{2}$Cl$_{2}$ (5
mL), were added pyridine (461~$\rmmu$L, 5.72 mmol, 4 {equiv}) and
compound \textbf{1} (633~mg, 1.43 mmol). The reaction mixture was
stirred for {45 min} at {rt} and then washed twice with
{H}$_{{2}}${O} ($2\times20$~mL). The organic phase was
dried over MgSO$_{4}$. Concentration under reduced pressure
followed by flash chromatography on a silica gel column using a mixture
{cyclohexane}/EtOAc 6:4 led to desired compound \textbf{2} as a white
solid in 93\% yield (807~mg). ${R}_{\mathrm{F}} = 0.52$
({cyclohexane} /EtOAc 6:4); $^{1}$H NMR (200~MHz, CD$_{3}$OD)
${\delta}$ (ppm): 8.33 (d, ${J} = 10.2$~Hz, 2H), 7.47 (d,
${J} = 10.2$~Hz, 2H), 5.02--4.92 (m, 1H), 3.84--3.50 (m, 4H),
2.18--2.09 (m, 1H), 1.60--1.50 (m, 10H), 1.45 (br s, 18H), 1,31--1.29
(m, 1H); $^{13}$C NMR (50 MHz, CD$_{3}$OD) ${\delta}$
(ppm): 157.7, 157.0, 153.5, 146.9, 126.27, 123.1, 113.8, 80.5, 79.7,
79.0, 51.7, 37.4, 37.2, 28.7, 26.1, 24.7; MS (ESI) ${m/z} = 630.4$
{[}M+Na{]}$^{+}$ (theoretical \textit{m/z}~630.3).\looseness=1

\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N-}}benzylcarbamate (\textbf{3a})} 
General procedure A was employed for the reaction between compound
\textbf{2} {(100 mg)} and \mbox{commercially} available benzylamine 
(20~$\rmmu$L). Compound \textbf{3a} was obtained after purification by
flash chromatography on a silica gel column using a mixture
{cyclohexane}/EtOAc 6:4 as a white solid in 88\% yield (81~mg).
${R}_{\mathrm{F}} = 0.25$ ({cyclohexane}/EtOAc 8:2); $^{1}$H
NMR (200~MHz, CDCl$_{3}$\textbf{)} ${\delta}$ (ppm): 7.34--7.24 (m,
5H), 4.30 (br s, 2H), 3.68--3.33 (m, 5H), 2.57--2.51 (m, 1H),
1.60--1.50 (m, 8H), 1.42--1.10 (m, 21H); $^{13}$C NMR (50 MHz,
CDCl$_{3}$) ${\delta}$ (ppm): 156.2, 155.3, 138.1, 128.8, 127.7, 127.6,
112.9, 80.0, 79.0, 74.6, 51.8, 36.4, 31.1, 29.8, 28.5, 25.1, 23.8; MS
(ESI) ${m/z} = 576.5$ {[}M${+}$H{]}$^{+}$ (theoretical \textit{m/z}
576.3).


\subsection{1,3-Bis-{\textit{N}}{-(tert-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{O}}{-{[}}{\textit{N}}{-}{\textit{m}}{-fluorobenzyl{]}-}{\textit{N}}-methyl carbamate (\textbf{3b})} 
General procedure A was employed for the reaction between compound
\textbf{2} {(100 mg)} and 3-fluorobenzylamine (24.7~$\rmmu$L).
Purification by flash chromatography on a silica gel column using a
mixture {cyclohexane}/EtOAc 7:3 afforded {the} desired product
\textbf{3b} in 83\% yield (80.7 mg). ${R}_{\mathrm{F}} = 0.54$
({cyclohexane}/EtOAc 6:4); $^{1}$H NMR (200 MHz, CD$_{3}$OD) ${\delta}$
(ppm): two isomers (minor one in italic): 7.38--7.28 (m, 1H),
7.08--6.96 (m, 3H), 4.96--4.85 (m, 2H), 4.58--4.38 (d, \textit{J}\ $=$\ 
15.8 Hz , 2H), 4.20--4.12 (d, ${J} = 16.0$~Hz, 1H), 3.76--3.46 (m,
4H), 2.89 (s, 3H), 2.85 (s, 3H), 2.18--2.10 (m, 1H), 1.65--1.25 (m,
29H); $^{13}$C NMR (50 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 166.9, 162.0,
158.1, 157.7, 157.3, 141.7, 131.4, 124.6, 115.4, 114.9, 113.4, 80.2,
79.8, 79.6, 76.8, 53.0, 52.7, 52.2, \textit{52.1}, 37.3, 37.1,
\textit{34.6}, 34.3, 30.7, 28.7, 26.1, 24.7; MS (ESI) \textit{m/z}
608.5 {[}M${+}$H{]}$^{+}$ (theoretical \textit{m/z} 608.3).

\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N}}{-(}{\textit{n-}}propylimidazole) carbamate (\textbf{3c})} 
General procedure A was employed for the reaction between compound
\textbf{2} {(100 mg)} and \mbox{commercially} available
1-(3-aminopropyl)imidazole (21.3~$\rmmu$L). Compound \textbf{3c} was
obtained after purification by flash chromatography on a silica gel
column using a mixture CH$_{2}$Cl$_{2}$/MeOH 95:5 as a white solid in
80\% yield (76 mg). ${R}_{\mathrm{F}} = 0.53$
(CH$_{2}$Cl$_{2}$/MeOH 9:1); $^{1}$H NMR (200 MHz, CD$_{3}$OD)
${\delta}$ (ppm): 7.75 (br s, 1H), 7.18 (br s, 1H), 7.00 (br s, 1H),
4.83--4.79 (m, 1H), 4.07 (t, ${J} = 6.2$~Hz, 2H), 3.72--3.43 (m,
4H), 3.11 (t, ${J} = 6.2$~Hz, 2H), 2.18--2.09 (m, 1H), 1.97
(quintuplet, ${J} = 6.2$~Hz, 2H), 1.60--1.50 (m, 8H), 1.45--1.29
(m, 21H,); $^{13}$C NMR (50 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 158.5,
157.7, 135.5, 120.8, 113.3, 112.4, 80.3, 79.7, 75.5, 52.4, 45.2, 38.5,
37.3, 37.2, 32.5, 28.7, 26.1, 24.7; MS (ESI): \textit{m/z} 594.4
{[}M${+}$H{]}$^{+}$  (theoretical \textit{m/z} 594.3).


\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N}}-(benzimidazole)carbamate (\textbf{3d})} 
General procedure A was employed for the reaction between compound
\textbf{2} {(100 mg)} and commercially available 2-aminobenzimidazole
(21.3~mg). Compound \textbf{3d} was obtained after purification by
flash chromatography on a silica gel column using a mixture cyclohexane
/EtOAc 1:1 as a white solid in 67\% yield (64.4 mg).
${R}_{\mathrm{F}} = 0.23$ ({cyclohexane}/EtOAc 6:4); $^{1}$H
NMR (200 MHz, DMSO\textit{-d6}) ${\delta}$ (ppm): 7.69 (br s, 1H),
7.19--7.11 (m, 4H), 7.00--6.92 (m, 1H), 5.13 (t, ${J} = 10.3$ Hz,
1H), 4.09--3.97 (m, 2H), 3.74--3.76 (m, 1H), 1.95--1.90 (m, 1H),
1.55--1.13 (m, 29H); $^{13}$C NMR (50~MHz, DMSO-\textit{d6}) ${\delta}$
(ppm): 155.1, 154.9, 153.3, 150.4, 142.8, 129.9, 120.0, 115.3, 114.3,
111.3, 78.0, 77.9, 77.8, 76.9, 35.9, 35.8, 28.2, 23.4, 23.3; MS (ESI)
\textit{m/z} 602.2 {[}M${+}$H{]}$^{+}$ (theoretical \textit{m/z} 602.3).

\subsection{1,3-Bis-{\textit{N}}-({\textit{tert}}-butyloxycarbonyl)-5,6-{\textit{O}}-cyclohexylidene-2-deoxystreptamine-4-{\textit{N}}-(pyridine)carbamate (\textbf{3e})} 
General procedure A was employed for the reaction between compound
\textbf{2} {(100 mg)} and commercially available 3-aminopyridine (16.9
mg). The reaction mixture was heated to 50~\textdegree C. Purification
by flash chromatography on a silica gel column using a mixture
CH$_{2}$Cl$_{2}$/MeOH 95:5 afforded desired compound \textbf{3e} as a
white solid in 33\% yield (29.7 mg). ${R}_{\mathrm{F}} = 0.46$
(CH$_{2}$Cl$_{2}$/MeOH 98:2); $^{1}$H NMR (200 MHz, CD$_{3}$OD)
${\delta}$ (ppm): 8.64 (br, 1H), 8.19 (dd, ${J} = 4.1$, 2.3 Hz),
8.00 (dd, ${J} = 4.1$, 2.3 Hz), 7.40 (q, ${J} = 4.1$ Hz, 1H),
5.02--4.97 (m, 1H), 3.80--3.47 (m, 4H), 2.13 (td, ${J} = 6.3$, 4.1
Hz, 1H), 1.60--1.50 (m, 9H), 1.46--1.20 (m, 20H); MS (ESI) \textit{m/z}
563.5 {[}M${+}$H{]}$^{+}$ (theoretical \textit{m/z} 563.3).

\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N}}{-(D}$_{3}$) carbamate (\textbf{3f})} 
General procedure A was employed for the reaction between compound
\textbf{2} {(100 mg)} and
\textit{N}-3-(1-(3-aminopropyl-1\textit{H}-imidazol-4-yl)phenyl)benzamide 
(78.1 mg). The reaction mixture was heated to {50~\textdegree C}.
Purification by flash chromatography on a silica gel column using a
mixture CH$_{2}$Cl$_{2}$/MeOH 95:5 afforded desired compound
\textbf{3e} as a white solid in 33\% yield (41.6 mg).
${R}_{\mathrm{F}} = 0.45$ (CH$_{2}$Cl$_{2}$/MeOH 9:1); $^{1}$H
NMR (200 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 9.57 (s, 1H), 8.30 (s, 1H),
8.05 (d, ${J} = 3.0$ Hz, 2H), 7.80--7.50 (m, 8H), 7.35--7.25 (m,
1H), 6.70--6.60 (m, 1H), 6.40--6.30 (m, 1H), 6.10--6.00 (m, 1H),
5.00--4.90 (m, 1H), 4.14 (t, ${J} = 2.5$ Hz, 2H), 3.90--3.80 (m,
1H), 3.80--3.60 (m, 4H), 3.00--2.90 (m, 2H), 2.30--2.20 (m, 1H),
1.60--1.50 (m, 11H), 1.41 (s, 18H); $^{13}$C NMR (50 MHz, CD$_{3}$OD)
${\delta}$ (ppm): 171.3, 166.3, 157.6, 157.4, 156.1, 140.5, 168.7,
136.7, 136.4, 132.3, 129.5, 129.2, 128.4, 120.9, 118.9, 117.3, 116.3,
112.2, 79.0, 74.7, 55.0, 52.5, 44.7, 38.5, 37.5, 37.0, 36.9, 25.6,
24.4; MS (ESI) \textit{m/z} 563.5 {[}M${+}$H{]}$^{+}$ (theoretical
\textit{m/z} 563.3).

\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N}}{-(}{\textit{n}}-butyl) carbamate (\textbf{3g})} 
General procedure B was employed for the reaction between compound
\textbf{1} {(100 mg)} and butyl isocyanate (38.3~$\rmmu$L). Compound
\textbf{3g} was obtained after purification of the crude product by
flash chromatography on a silica gel column using a mixture
{cyclohexane}/EtOAc 7:3 as a white solid in 90\% yield (112~mg).
${R}_{\mathrm{F}} = 0.61$ ({cyclohexane}/EtOAc 6:4); $^{1}$H
NMR (200~MHz, CD$_{3}$OD) ${\delta}$ (ppm): 4.84--4.74 (m, 1H),
3.70--3.41 (m, 4H), 3.10 (t, ${J} = 6.1$ Hz, 2H), 2.17--2.05 (td,
${J} = 4.2$, 12.4 Hz, 1H), 1.60--1.50 (m, 9H), 1.55--1.41 (m,
24H), 1.17 (t, ${J} = 6.1$ Hz, 1H), 0.95 (t, ${J} = 6.1$ Hz,
3H); $^{13}$C NMR (50 MHz, CD$_{3}$OD) ${\updelta}$ (ppm): 158.4,
157.7, 113.3, 79.7, 79.7, 75.3, 52.4, 41.5, 37.3, 33.1, 28.7, 26.1,
24.7, 20.9, 14.16; MS (ESI) \textit{m/z} 542.4 {[}M${+}$H{]}$^{+}$
(theoretical \textit{m/z} 542.3).

\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N}}{-{[}}{\textit{n-}}ethyl-(2$'$,4$'$-dichlorophenyl){]} carbamate (\textbf{3h})} 
General procedure B was employed for the reaction between compound
\textbf{1} {(100 mg)} and 2,4-dichloro-1-(2-isocyanatoethyl)benzene (56
$\rmmu$L). Compound \textbf{3h} was obtained after purification of the
crude product by flash chromatography on a silica gel column using a
mixture {cyclohexane}/EtOAc 85:15 as a white solid in 56\% yield (85
mg). ${R}_{\mathrm{F}} = 0.64$ ({cyclohexane}/EtOAc 6:4);
$^{1}$H NMR (200 MHz, acetone-\textit{d6}) ${\delta}$ (ppm): 7.46--7.30
(m, 3H), 6.57 (br, 1H), 4.92--4.82 (m, 1H), 3.77--3.53 (m, 4H),
3.39--3.29 (m, 2H), 3.00--2.89 (m, 2H), 2.31--2.24 (m, 1H), 1.60--1.50
(m, 9H), 1.62--1.28 (m, 20H); $^{13}$C NMR (50 MHz,
Acetone-\textit{d6}) ${\updelta}$ (ppm): 157.1, 156.1, 136.9, 135.4,
133.3, 133.2, 129.7, 128.1, 112.2, 79.1, 78.9, 74.7, 52.5, 49.2, 41.2,
37.4, 33.1, 28.6, 27.5, 25.7, 24.4; MS (ESI) ${m/z} = 658.1$
{[}M${+}$H{]}$^{+}$ (theoretical \textit{m/z} 658.3).


\subsection{1,3-Bis-{\textit{N}}{-(}{\textit{tert}}{-butyloxycarbonyl)-5,6-}{\textit{O}}{-cyclohexylidene-2-deoxystreptamine-4-}{\textit{N}}{-{[}}{\textit{n-}}ethyl-(4$'$-fluorophenyl){]} carbamate (\textbf{3i})} 
General procedure B was employed for the reaction between compound
\textbf{1} (100 mg) and commercially available
1-fluoro-4-(2-isocyanatoethyl)benzene (49~$\rmmu$L). Compound
\textbf{3i} was obtained after purification of the crude product by
flash chromatography on a silica gel column using a mixture
{cyclohexane}/EtOAc 8:2 as a white solid in 59\% yield (82~mg).
${R}_{\mathrm{F}} = 0.53$ ({cyclohexane}/EtOAc 6:4); $^{1}$H
NMR (200~MHz, acetone-\textit{d6}) ${\delta}$ (ppm): 7.26--6.93 (m,
4H), 4.81--4.77 (m, 1H), 3.71--3.34 (m, 4H), 3.33--3.26 (m, 2H),
2.88--2.77 (m, 2H), 2.16--2.09 (m, 1H), 1.60--1.50 (m, 7H), 1.47--1.29
(m, 22H); $^{13}$C NMR (50~MHz, acetone-\textit{d6}) ${\delta}$ (ppm):
158.3, 157.7, 136.4, 133.3, 131.6, 131.4, 116.2, 115.8, 113.3, 80.3,
79.7, 75.4, 71.34, 52.4, 43.5, 37.3, 37.3, 36.2, 28.7, 26.11, 24.74,
23.94; MS (ESI): ${m/z} = 608.1$ {[}M${+}$H{]}$^{+}$ (theoretical
\textit{m/z} 608.3).


\subsection{2-Deoxystreptamine-4-{{\textit{O}}}{-(}{{\textit{N}}}-phenyl) carbamate (\textbf{4a})} 
{General procedure C} {was applied for the protection of compound}
{\textbf{3a}} {(50 mg, 0.087 mmol) in the presence of TFA (323
$\rmmu$L, 50} {{equiv}}{) and triethylsilane (TIS, 0.89~$\rmmu$L, 4.3
nmol, 0.05} {{equiv}}{) in a mixture of CH}$_{2}${Cl}$_{2}$ {and
H}$_{2}${O (2.6 mL, 3:1). Compound} {\textbf{4a}} {was obtained as a
white solid in 44\% yield (20~mg).} ${{t}}_{{R}} =
0.68$~min (analytical HPLC method); $^{1}${H NMR (200~MHz,
CD}$_{3}${OD)} {${\delta}$} {(ppm): 7.33--7.23 (m, 5H), 4.77--4.67 (m,
1H), 4.34 (q,} {\textit{J}}\ {$=$\ 15.2 Hz, 2H), 3.68--3.38 (m, 3H),
3.25--3.22 (m, 1H), 2.48--2.41 (m, 1H), 1.90--1.69 (m, 1H);} $^{13}${C
NMR (50 MHz, CD}$_{3}${OD)} {${\delta}$} {(ppm): 156.2, 140.1, 129.5,
128.8, 128.4, 128.2, 76.2 75.2, 51.3, 45.9, 30.1; HRMS (ESI)}
{\textit{m/z}}\ {$=$\ 296.16061 {[}M${+}$H{]}}$^{+}$
{(C}$_{14}${H}$_{22}${O}$_{4}${N}$_{3}$ {requires
296.16048).}

\vspace*{-2pt}

\subsection{2-Deoxystreptamine-4$'$-{\textit{O}}{-{[}}{\textit{N}}{-}{\textit{m}}{-fluorophenyl{]}-}{\textit{N}}-methyl carbamate (\textbf{4b})} 
General procedure C was applied for the deprotection of compound
\textbf{3b} (80 mg, 0.13 mmol) in the presence of TFA (489~$\rmmu$L, 50
{equiv}) and TIS (1.33~$\rmmu$L, 6.5~mmol, 0.05 {equiv}) in a mixture
of CH$_{2}$Cl$_{2}$ and H$_{2}$O (4.5 mL, 3:1). Compound \textbf{4b}
was obtained as a white solid in 67\% yield (48 mg).
${t}_{R} = 0.79$ min (analytical HPLC); $^{1}$H NMR
(500 MHz, CD$_{3}$OD\textbf{)} ${\delta}$ (ppm): two isomers (minor one
in italics): 7.37--7.32 (m, 1H), 7.18--6.98 (m, 3H), 4.84--4.73 (m,
2H), 4.37 (d, ${J} = 16.0$~Hz, 2H), 4.30 (d, ${J} = 15.5$ Hz,
1H), 3.56--3.45 (m, 3H), 3.26--3.20 (m, 1H), 2.96 (s, 3H), 2.87 (s,
3H), 2.49--2.47 (m, 1H), 1.90--1.83 (m, 1H); $^{13}$C NMR (125 MHz,
CD$_{3}$OD) ${\delta}$ (ppm) two isomers (minor one in italics): 165.5,
163.6, 141.5, 131.5, 124.7, 115.6, 115.1, 76.4, 77.4, 74.9,
\textit{54.8, 53.2}, 52.9, 51.3, 51.2, 34.7, 34.4, 30.3; HRMS (ESI)
${m/z} = 328.16681$ {[}M${+}$H{]}$^{+}$
(C$_{15}$H$_{23}$O$_{4}$N$_{3}$F requires
328.16671). 


\subsection{2-Deoxystreptamine-4-{{\textit{O}}}-({{\textit{N}}}-propylimida\-zole) carbamate (\textbf{4c})} 
{General procedure C} {was applied for the deprotection of compound}
{\textbf{3c}} {(78 mg, 0.13 mmol) in the presence of TFA (483~$\rmmu$L,
50} {{equiv}}{) and TIS (1.33~$\rmmu$L, 6.5~mmol, 0.05} {{equiv}}{) in
a mixture of CH}$_{2}${Cl}$_{2}$ {and H}$_{2}${O (4.2 mL, 3:1).
Compound} {\textbf{4c}} {was obtained as a colorless solid in 61\%
yield (25 mg).} ${{t}}_{{R}} = 0.68$~min (analytical
HPLC); $^{1}${H NMR (200 MHz, CD}$_{3}${OD)} {${\delta}$} {(ppm): 8.96
(br s, 1H), 7.69 (br s, 1H), 7.58 (br s, 1H), 4.82--4.76 (m, 1H), 3.45
(t,} {\textit{J}}\ {$=$\ 6.3, 2H), 3.49--3.16 (m, 4H), 3.14 (t,}
{\textit{J}}\ {$=$\ 6.3 Hz, 2H), 2.51--2.40 (m, 1H), 2.15--2.11 (m, 2H),
1.63--1.29 (m, 29H);} $^{13}${C NMR (50 MHz, CD}$_{3}${OD)}
{${\delta}$} {(ppm): 158.4, 133.2, 121.7, 111.4, 76.1, 75.2, 74.2,
51.4, 49.0, 38.1, 38.1, 31.5, 23; HRMS (ESI)} {\textit{m/z}}\ {$=$\ 
314.18240 {[}M${+}$H{]}}$^{+}$
{(C}$_{13}${H}$_{24}${O}$_{4}${N}$_{5}$ {requires 314.18228).}


\subsection{2-Deoxystreptamine-4-{{\textit{O}}}{-{[}}{{\textit{N}}}-benzimida\-zole{]} carbamate (\textbf{4d})} 
{General procedure C was applied for the deprotection of compound}
{\textbf{3d}} {(50 mg, 0.083 mmol) in the presence of TFA (726
$\rmmu$L, 50} {{equiv}}{) and TIS (0.85~$\rmmu$L, 4.1 mmol) in a
mixture of CH}$_{2}${Cl}$_{2}$ {and H}$_{2}${O (3 mL, 2:1). Compound}
{\textbf{4d}} {was obtained as a colorless solid in 30\% yield (13.7
mg).} ${{t}}_{{R}} = 1.23$ min (analytical HPLC).
$^{1}${H NMR (500 MHz, CD}$_{3}${OD)} {${\delta}$} {(ppm): 7.38--7.25
(m, 4H), 4.81--4.68 (m, 1H), 3.59--3.45 (m, 3H), 3.29--3.16 (m, 1H),
2.51--2.40 (m, 1H), 1.94--1.81 (m, 1H);} $^{13}${C NMR (125 MHz,
CD}$_{3}${OD)} {${\delta}$} {(ppm): 163.5, 158.4, 131.0, 124.7, 112.3,
81.3 79.3, 74.7, 51.2, 29.9; HRMS (ESI)} {\textit{m/z}}\ {$=$\ 322.15103
{[}M${+}$H{]}}$^{+}$
{(C}$_{14}${H}$_{20}${O}$_{4}${N}$_{5}$ {requires 322.15098).}


\subsection{2-{{{D}}}{{eoxystreptamine-4-}}{{\textit{O}}}{-(}{{\textit{N}}}-pyridine) carbamate (\textbf{4e})} 
{General procedure C} {was applied for the deprotection of compound}
{\textbf{3e}} {(40 mg, 0.071 mmol) in the presence of TFA (264
$\rmmu$L, 50} {{equiv}}{) and TIS (0.72~$\rmmu$L, 3.5 mmol) in a
mixture of CH}$_{2}${Cl}$_{2}$ and H$_{2}$O (2.2 mL, 3:1). Compound
{\textbf{4e}} {was obtained as a colorless solid in 22\% yield (8.0
mg).} ${{t}}_{{R}} = 0.63$ min (analytical HPLC);
$^{1}${H NMR (200 MHz, CD}$_{3}${OD)} {${\delta}$} (ppm): 8.97 (br,
1H), 8.41 (br, 1H), 8.28 (d, $J = 8.4$ Hz, 1H), 7.75 (br,
1H), 4.95--4.80 (m, 1H), 3.67--3.19 (m, 3H), 3.27--3.19 (m, 1H), 2.54
-- 2.43 (td, $J = 12.1$, 4.2 Hz, 1H), 1.97--1.78 (q,
$J = 12.1$ Hz); HRMS (ESI) ${{m/z}} = 283.14020$
{[}M${+}$H{]}$^{+}$
(C$_{12}${H}$_{19}${O}$_{4}${N}$_{4}$ requires 283.14008).


\subsection{2-{{D}}{eoxystreptamine-4-}{\textit{N}}{-(D}$_{3}$) carbamate (\textbf{4f})} 
General procedure C was applied to compound \textbf{3f} (100 mg, 0.127
mmol) in the presence of TFA (490~$\rmmu$L, 50 {equiv}) in a mixture of
CH$_{2}$Cl$_{2}$ and H$_{2}$O (2 mL, 3:1). Compound \textbf{4f} was
obtained as a colorless solid in 75\% yield (70.0 mg).
${t}_{R} = 1.48$ min (analytical HPLC); $^{1}$H NMR
(500 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 9.57 (s, 1H), 8.30 (s, 1H),
8.05 (d, J $=$ 20 Hz, 2H), 7.80--7.50 (m, 8H), 7.35--7.25 (m, 1H),
6.60--6.50 (m, 1H), 6.35--6.25 (m, 1H), 5.00--4.90 (m, 1H), 4.20--4.10
(m, 2H), 3.70--3.50 (m, 4H), 3.00--2.90 (m, 2H), 2.35--2.25 (m, 1H),
1.70--1.50 (m, 10H), 1.40--1.50 (m, 19H); $^{13}$C NMR (125 MHz,
CD$_{3}$OD) ${\delta}$ (ppm): 168.9, 158.3, 140.9, 137.2, 135.9, 135.8,
133.0, 130.9, 129.5, 128.7, 128.5, 123.1, 122.5, 119.2, 119.0, 75.9,
75.1, 74.1, 51.1, 50.0, 47.6, 38.0, 31.2, 29.8, 23.7; HRMS (ESI)
${m/z} = 509.25095$ {[}M${+}$H{]}$^{+}$
(C$_{26}$H$_{33}$O$_{5}$N$_{6}$~requires 509.25069).\looseness=1


\subsection{2-Deoxystreptamine-4-{{\textit{O}}}{-(}{{\textit{N}}}-butyl) carbamate (\textbf{4g})} 
{General procedure C} {was applied to compound} {\textbf{3g}} {(100 mg,
0.18 mmol) in the presence of TFA (668~$\rmmu$L, 50} {{equiv}}{) in a
mixture of CH}$_{2}${Cl}$_{2}$ {and H}$_{2}${O (4.5 mL, 3:1). Compound}
{\textbf{4g}} {was obtained as a colorless solid in 88\% yield (77.5
mg).} ${{t}}_{{R}} = 0.77$ min (analytical HPLC);
$^{1}${H NMR (200 MHz, CD}$_{3}${OD)} {${\delta}$} {(ppm): 4.71--4.61
(m, 1H), 3.45--3.06 (m, 6H), 2.46--2.40 (m, 1H), 1.89--1.77 (m, 1H),
1.55--1.27 (m, 4H), 0.94 (t,} ${{J}} = 6.3$~Hz, 2H); $^{13}${C
NMR (50 MHz, CD}$_{3}${OD)} {${\delta}$} {(ppm): 158.4, 76.1, 75.1,
74.3, 51.3, 41.8, 40.3, 32.9, 21.0, 14.1; HRMS (ESI)} {\textit{m/z}}\ {$=$\ 
262.17624 {[}M${+}$H{]}}$^{+}$
{(C}$_{11}${H}$_{24}${O}$_{3}${N}$_{3}$ {requires
262.17613).}

\subsection{2-Deoxystreptamine-4-{\textit{O}}{-{[}}{\textit{N}}-(2$'$,4$'$-dichlorophenyl)ethyl{]} carbamate (\textbf{4h})} 
General procedure C was applied to compound \textbf{3h} (55 mg, 0.084
mmol) in the presence of TFA (312~$\rmmu$L, 50 {equiv}) in a mixture of
CH$_{2}$Cl$_{2}$ and H$_{2}$O (2.5 mL, 3:1). Compound \textbf{4h} was
obtained as a white solid in quantitative yields (50.8 mg).
${t}_{R} = 0.69$ min (analytical HPLC); $^{1}$H NMR
(500 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 7.44--7.43 (m, 1H), 7.35--7.24
(m, 2H), 4.73--4.63 (m, 1H), 3.51--3.37 (m, 3H), 3.35--3.32 (m, 3H),
2.99--2.91 (m, 2H), 2.47--2.40 (m, 1H), 1.90--1.72 (m, 1H); $^{13}$C
NMR (125 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 158.3, 136.9, 135.9, 134.0,
133.3, 130.1, 76.3, 75.3, 74.1, 51.2, 41.8, 33.8, 30.2; HRMS (ESI)
${m/z} = 378.09857$ {[}M${+}$H{]}$^{+}$
(C$_{15}$H$_{22}$O$_{4}$N$_{3}$Cl$_{2}$ requires
378.09819). 

\subsection{2-Deoxystreptamine-4-{\textit{O}}-[4$'$-(fluorophenyl){\ubreak}ethyl{]} 
carbamate (\textbf{4i})} 
General procedure C was applied to compound \textbf{3i} (45 mg, 0.079
mmol) in the presence of TFA (293~$\rmmu$L, 50 {equiv}) in a mixture of
CH$_{2}$Cl$_{2}$ and H$_{2}$O (1.5~mL, 3:1). Compound \textbf{4i} was
obtained as a colorless solid in 52\% yield (23 mg).
${t}_{R} = 0.95$ min (analytical HPLC); $^{1}$H NMR
(500 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 7.28--7.22 (m, 2H), 7.21--6.94
(m, 2H), 4.74--4.64 (m,~1H), 3.49--3.37 (m, 3H), 3.31--3.27 (m, 2H),
3.24--3.20 (m, 1H), \mbox{2.84--2.77} (m, 2H), 2.49--2.41 (m, 1H), 1.91--1.72
(m, 1H); 13C NMR (125 MHz, CD$_{3}$OD) ${\delta}$ (ppm): 158.2, 156.6,
131.6, 131.4, 116.3, 115.9, 76.0, 74.9, 74.2, 51.2, 43.8, 36.0, 30.0;
HRMS (ESI) ${m/z} = 328.16678$ {[}M${+}$H{]}+
(C$_{15}$H$_{23}$FN$_{3}$O$_{4}$ requires
328.16726).

Interestingly, 2D-NMR analysis of conjugate \textbf{3b} as well as its
corresponding deprotected form \textbf{4b} containing 2-DOS connected
to a 2-fluoro-\textit{N}-methylbenzylamine moiety clearly showed two
distinct rotamers. This could be due to the presence of the methyl
group on the nitrogen atom of the carbamate linker, which probably
impedes free rotation of the carbamate function. In the absence of this
methyl group, no steric effect is found to restrict this free rotation,
thus no observation of two conformations was detected by NMR analysis.

\section{Biochemistry}

\subsection{RNA and biochemicals}
The buffers and solutions used in the fluorescence experiments were
filtered through Millipore filters (0.22 mm; GP ExpressPLUS membrane).
Human recombinant Dicer enzyme (Genlantis) had a concentration of 0.5
U/$\rmmu$L. Tris(hydroxymethyl)aminomethane hydrochloride (Tris--HCl)
20~mM (pH 7.4), containing 12~mM NaCl, 3~mM MgCl$_{{2}}$, and 1~mM DTT
was used for the FRET assays and $K_{\mathrm{D}}$ determination. RNA
oligonucleotides were purchased from IBA GmbH (Goettingen, Germany).
RNA folding was performed in TRIS buffer upon incubation at
{90~\textdegree C} for 2 min, {4~\textdegree C} for {10 min}, and
slowly returning to room temperature for 15~min. 

For pre-miR-372: 

5$'$-FAM-GUGGGCCUCAAAUGUGGAGCACUAUU{\ubreak}CUGAUGUCCAAGUGGAAAGUGCUGCGACAUUUG{\ubreak}AGCGUCAC-3$'$-DABCYL (ODN1)

5$'$-FAM-GUGGGCCUCAAAUGUGGAGCACUAUU{\ubreak}CUGAUGUCCAAGUGGAAAGUGCUGCGACAUUUG{\ubreak}AGCGUCAC-3$'$ (ODN2)

For pre-miR-17:


5$'$-FAM-GUCAGAAUAAUGUCAAAGUGCUUACAG{\ubreak}UGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGA{\ubreak}AGGCACUUGUAGCAUUAUGGUGAC-3$'$-DABCYL (ODN3)


5$'$-FAM-GUCAGAAUAAUGUCAAAGUGCUUACAG{\ubreak}UGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGA{\ubreak}AGGCACUUGUAGCAUUAUGGUGAC-3$'$ (ODN4)


{For pre-miR-18a:}


5$'$-FAM-UGUUCUAAGGUGCAUCUAGUGCAGAU{\ubreak}AGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGC{\ubreak}UCCUUCUGGCA-3$'$-DABCYL (ODN5)


5$'$-FAM-UGUUCUAAGGUGCAUCUAGUGCAGAU{\ubreak}AGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGC{\ubreak}UCCUUCUGGCA-3$'$ (ODN6) 


{For pre-miR-148a:}


5$'$-FAM-GAGGCAAAGUUCUGAGACACUCCGACU{\ubreak}CUGAGUAUGAUAGAAGUCAGUGCACUACAGAACU{\ubreak}UUGUCUC-3$'$-DABCYL (ODN7)


5$'$-FAM-GAGGCAAAGUUCUGAGACACUCCGACU{\ubreak}CUGAGUAUGAUAGAAGUCAGUGCACUACAGAACU{\ubreak}UUGUCUC-3$'$ (ODN8) 


{DNA duplex sequence:} 


5$'$-CGTTTTAAATTTTGC-3$'$ (ODN9) and 5$'$-GCTT{\ubreak}TTAAATTTTGC-3$'$

\subsection{FRET Dicer assay} 
{The Dicer assay was performed in 384-well plates (Greiner bio-one) in
a final volume of 40~$\rmmu$L by using a 5070 EpMotion automated
pipetting system (Eppendorf). Each experiment was performed in
duplicate and repeated three times. A beacon of ODN1, ODN3, ODN5, or
ODN7 at 50 nM was used in each well and the reaction mixtures
containing inhibitors were preincubated at} {{rt}} {for 30 min. Human
recombinant Dicer (0.25 U; Genlantis) or} {{\textit{Escherichia coli}}}
{RNase III (0.25 U, Ambion) were added to the reaction mixtures. For
the IC}$_{50}$ {experiments, each ligand was added in 12 dilutions
(0.244 pM--500 $\rmmu\mathrm{M}$). The fluorescence increase was
measured after} {{1 h}} {incubation at} {{37~\textdegree C}} on a
GeniosPro (Tecan) with excitation and emission filters of l $=$ 485
${\pm}$ 10 and 535 ${\pm}$ 15 nm, respectively. Each point was measured
ten times with an integration time of 500 ms and then averaged. The
inhibition data were analyzed using nonlinear regression in Prism 5
(GraphPad Software) following the equation: Y $=$ bottom\ $+$\ (top\ $-$\ 
bottom)/(1\ $+$\  10$^{{[}(\log(\mathrm{IC}_{50}) - \mathrm{X})\cdot 
\mathrm{Hills}~\mathrm{Slope}{]}}$) where $\mathrm{X}$ is log(concentration) and Y the fluorescence intensity.

\subsection{Binding experiments and {\textit{K}}$_{\mathrm{D}}$ determination} 
Binding experiments were performed in 384-well plates (Greiner bio-one)
in a final volume of 60 mL by using a 5070 EpMotion automated pipetting
system (Eppendorf). Each experiment was performed in duplicate and
repeated at least three times. A beacon (ODN2, ODN4, ODN6 and ODN8) was
used at 10 nM in each well. Each ligand was added in 15 dilutions
(0.030 nM--0.5 mM). The fluorescence increase measured after 4 h on a
GeniosPro (Tecan) with excitation and emission filters of $l = 485
\pm 10$ and 535 ${\pm}$ 15 nm, respectively. Each point was measured
ten times with an integration time of 500 ms and then averaged. The
binding data were analyzed using Graphpad Prism 5 software. Unless
otherwise stated, the binding profiles were well fitted by a simple
model that assumed 1:1 stoichiometry. In the competition experiments,
100 {equiv} of tRNA structured as pre-miR-372 beacon were added to the
RNA solution and 100 {equiv} of duplex DNA (mixture of ODN9 and ODN10
incubated at {90~\textdegree C} for {5 min} then slowly returned at
{rt}) were added to the RNA solution. 


\subsection{Molecular modeling and docking}
{The MC-Fold/MC-Sym pipeline
(}\url{http://www.major.iric.ca/MC-Pipeline/}{) is a web-hosted service
for RNA secondary and tertiary structure prediction. The pipeline
consists in uploading RNA sequence to MC-Fold, which outputs secondary
structures that are directly input to MC-Sym, which outputs tertiary
structures. Pre-miRNA sequences were obtained from the miRBase database
(}\url{http://www.mirbase.org/}{). The hairpin loops of pre-miR-372 and
pre-miR-17 were chosen to predict the 3D structure using the
MC-Fold/MC-Sym pipeline. Energy optimization was further conducted on
the 3D model using the TINKER Molecular Modeling Package
(}\url{http://dasher.wustl.edu/tinker/}{). For docking with AutoDock,
polar hydrogen atoms, Kollman united charges and solvent parameters
were applied to the RNA using pmol2q script. This script converts the
.pdb file format of the RNA template to the .pdbqt file format that is
compatible with AutoDock program version 4
(}\url{http://autodock.scripps.edu/}{). Pre-miR-372/}{\textbf{4f}} {and
pre-miR17/}{\textbf{4f}} {molecular docking were conducted using
AutoDock program version 4. The rotational bonds of the ligand were
treated as flexible, whereas the receptor was kept rigid. Grid box was
fixed in order to include the entire RNA sequence. RNA--ligand
interactions were analyzed and visualized using Discovery Studio
Visualizer version 4.1
(\url{https://www.3ds.com/fr/products/biovia/discovery-studio}).}
\looseness=1

\section*{Declaration of interests}

The authors do not work for, advise, own shares in, or receive funds
from any organization that could benefit from this article, and have
declared no affiliations other than their research organizations.

\section*{Supplementary materials}

Supporting information for this article is available on the journal's
website under \printDOI\ or from the author.  

\CDRsupplementaryTwotypes{supplementary-material}{\cdrattach{crchim-426-suppl.pdf}}

\back{}

\printbibliography
\refinput{crchim20250744-reference.tex}

\end{document}