Outline
Comptes Rendus

Molecular biology and genetics / Biologie et génétique moléculaires
A molecular study of Tunisian populations of Dugesia sicula (Plathelminthes, Tricladida) through an identification of a set of genes
Comptes Rendus. Biologies, Volume 342 (2019) no. 9-10, pp. 291-298

Abstract

Cell regeneration is a natural repair of different types of tissue after an injury or a lesion, and is associated with asexual reproduction in some animals such as planarians. Its understanding and improvement could have repercussions for tissue repair and regeneration as far as humans are concerned. In this context, we have proceeded to an essential step, which is the identification of the genes involved in planarian regeneration in the model species. Dugesia sicula Lepori (Dsicula) is distributed around the Mediterranean Sea, and this population is found in most of Tunisian dams. The collection of identified genes is already known in other species. DjFoxG, DjPC2, DjotxA, and Cathepsin-D were identified by the PCR technique and their expression was confirmed by RT-PCR and in situ hybridization. DjFoxG gene, the FoxG1 homolog, is expressed throughout the planarian body, abundantly on stem cells. Consecutively, we choose a central nervous system (CNS) marker; the prohormone convertase 2 (DjPC2) gene. DjotxA was observed in the brain and especially in the region surrounding the eyes (visual cells). The regenerative cells of the gut of Dsicula were scored by the Cathepsin-D gene expression, which belongs to the aspartyl protease family. We found significant results through RT-PCR and In Situ Hybridization (ISH) techniques, confirming the expression of DjFoxG, DjPC2, DjotxA and Cathepsin-D genes in our specimens.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2019.10.005
Keywords: Dugesia sicula, DjFoxG, DjPC2, DjotxA, Cathepsin-D

Emna Meddeb  1 , 2 ; Mohamed Charni  3 , 4 ; Rim Ben Abdallah  1 , 3 ; Faten Raboudi  5 ; Sami Fattouch  1

1 Laboratory of Food and Molecular Biochemistry, National Institute of Applied Sciences and Technology (INSAT), University of Carthage, Zone Urbaine Nord, 1080 Tunis, Tunisia
2 Faculty of Sciences of Bizerte, University of Carthage, Tunis, Tunisia
3 Faculty of Sciences of Tunis, University of Tunis El Manar, Tunis, Tunisia
4 College of Sciences and Humanities of Dawadmi, Shaqra University, Shaqra, Kingdom of Saudi Arabia
5 ISAJC, Bir El Bey, University of Tunis, Tunis, Tunisia
Emna Meddeb; Mohamed Charni; Rim Ben Abdallah; Faten Raboudi; Sami Fattouch. A molecular study of Tunisian populations of Dugesia sicula (Plathelminthes, Tricladida) through an identification of a set of genes. Comptes Rendus. Biologies, Volume 342 (2019) no. 9-10, pp. 291-298. doi: 10.1016/j.crvi.2019.10.005
@article{CRBIOL_2019__342_9-10_291_0,
     author = {Emna Meddeb and Mohamed Charni and Rim Ben Abdallah and Faten Raboudi and Sami Fattouch},
     title = {A molecular study of {Tunisian} populations of {\protect\emph{Dugesia} sicula} {(Plathelminthes,} {Tricladida)} through an identification of a set of genes},
     journal = {Comptes Rendus. Biologies},
     pages = {291--298},
     year = {2019},
     publisher = {Elsevier},
     volume = {342},
     number = {9-10},
     doi = {10.1016/j.crvi.2019.10.005},
     language = {en},
}
TY  - JOUR
AU  - Emna Meddeb
AU  - Mohamed Charni
AU  - Rim Ben Abdallah
AU  - Faten Raboudi
AU  - Sami Fattouch
TI  - A molecular study of Tunisian populations of Dugesia sicula (Plathelminthes, Tricladida) through an identification of a set of genes
JO  - Comptes Rendus. Biologies
PY  - 2019
SP  - 291
EP  - 298
VL  - 342
IS  - 9-10
PB  - Elsevier
DO  - 10.1016/j.crvi.2019.10.005
LA  - en
ID  - CRBIOL_2019__342_9-10_291_0
ER  - 
%0 Journal Article
%A Emna Meddeb
%A Mohamed Charni
%A Rim Ben Abdallah
%A Faten Raboudi
%A Sami Fattouch
%T A molecular study of Tunisian populations of Dugesia sicula (Plathelminthes, Tricladida) through an identification of a set of genes
%J Comptes Rendus. Biologies
%D 2019
%P 291-298
%V 342
%N 9-10
%I Elsevier
%R 10.1016/j.crvi.2019.10.005
%G en
%F CRBIOL_2019__342_9-10_291_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

To understand the functioning of different phenomena in planarians, it is crucial to study, at first, the expression of several genes using classic but essential techniques such as PCR, RT-PCR, and in situ hybridization (ISH). The frequently used species were Dugesia japonica, Dugesia tigrina and Schmidtea mediterranea, but in our work we have focused on the Tunisian specimen Dugesia sicula Lepori, and therefore this extends molecular research. This work is considered as the mandatory stage maintained before carrying out specific studies on this selected species. Planarians are the best model to understand the regeneration phenomenon that fascinates humans since decades. For this reason, we targeted stem cells, responsible factors of regenerative property in flatworms [1]. We choose DjFoxG, since it is the first gene found in planarian stem cells populations [2]. It belongs to the Fox gene family, whose name is forkhead box, and it is related to the Drosophila gene fork head, corresponding to transcription factors [3]. Then we targeted the central nervous system (CNS); there are several genes having major roles in the CNS, such as the neural and cervical ones, coding for protein receptors, hormones, peptides, and others [4]. The DjPC2 gene was selected and it is a neuropeptide expressed profusely in the planarian central nervous system and previously found in the sensory and motor neurons clusters [5]. It is affiliated to the subtilisin/kexin family containing the precursor convertases, possessing activities in endocrine and neuroendocrine systems [6]. DjotxA is a good visual cells marker, it was expressed in the cephalic ganglion, but more medially in the termini of the visual axons in Djaponica [7]. Finally, we targeted the aspartyl protease Cathepsin-D gene to stain the digestive system of Dsicula. This protease acts in the process of hemoglobin digestion by schistosomes after blood feeding from humans [8], as it contributes to protein digestion in the gut of planarians [9].

2 Material and methods

2.1 Planarians

Dsicula specimens were provided by Dr. Mohamed Charni, as explained previously [10,11] and maintained as described by Molina et al. (2007) [12] as currently for Djaponica due to their phylogenetic rapprochement [13]. We denote the specimens collected from the Joumin dam by s1 and from Boussadia by s2.

2.2 In silico sequences analysis

Several software tools have been exploited in our work. The alignment concerns only the species maintained in the laboratory, which are Smediterranea, Djaponica, and Dsicula and it is based on their COI (cytochrome c oxidase subunit I) mitochondrial genes. We downloaded the nucleotide sequences of Cathepsin-D, DjFoxG, DjotxA, and DjPC2 genes already identified in Djaponica due to its phylogenetic proximity with our species. To align the selected sequences, we used ClustalX, which also included phylogenetic analysis in coordination with Njplot to confirm this phylogeny [14]. We examined the percentage of homology between Dug. japonica and Dug. sicula sequences through DNAMAN data [15]. The BLAST (Basic Local Alignment Search Tool) program, based on GeneBank, had also ensured alignment and analysis sequence similarities [16]. For the polymerase chain reaction (PCR), a silico simulation was carried out, and it is about OLIGO 7 [17]. The data obtained using the software also allowed us to design the primers.

2.3 Reverse transcriptase–PCR reaction

To start RNA extraction, we transferred five planarians from each specimen into 1.5-ml tubes. To lyse cells, we froze worms in liquid nitrogen for 5 to 10 s. After adding 400 μl of Trizol reagents and homogenizing worms, we appended 80 μl of chloroform. The mixture was centrifuged at 12,000 g for 15 min at 4 °C, then we collected the supernatant. For RNA precipitation, 200 μl of isopropanol were added and centrifuged for 10 min in the same conditions. We keep the pellet containing RNA, then we washed it with 1 ml of ethanol 75%. It was allowed to dry after centrifugation at 7500 g for 5 min at 4 °C, then dissolved in 20 μl of nuclease free water. Then, to synthesize cDNA, we added to the obtained RNA (2 μg) 1 μl of 50 μM oligo (dT)20 and nuclease-free water up to a total volume of 12 μl, then we incubated this synthesis reaction medium at 65 °C for 5 min. A mixture of reagents composed from 5x Reaction buffer, 10 mM dNTP Mix, Ribolock RNAase, an inhibitor (20 U/μl), a RevertAid H Minus M-Mulv and a Reverse Transcriptase (200 U/μl) in a total volume of 20 μl was added to the 12-μl synthesis reaction medium. It was incubated at 42 °C for 60 min, then at 70 °C for 5 min. After cDNA synthesis, a PCR reaction was prepared as described in Sandmann et al. (2011) [18]. The primers to amplify DjFoxG, DjPC2, DjOtxA and Cathepsin-D fragments were successively designed as displayed in Table 1.

Table 1

Primers designed by the OLIGO 7 data for DjFoxG, DjPC2, DjotxA, and Cathepsin-D gene fragments.

Table 1
Genes Forward (5’-3’) Reverse (5’-3’)
DjFoxG TTGATAATGATGGCAATTCG TTAATTTGCCTGTTGTTCC
DjPC2 ACACTGGACAAGCTGATGGA AACGCCCTCTACAATTGCAC
DjotxA GCAGTTGTTATGTAGCTGGCA CGTGTTGATGCTGATGTCGA
Cathepsin-D GGCTTATCCGTCCATTTCAGT AAGAAGAAAATTGCGCCCAG

PCR cycling conditions have been adjusted and each one had different annealing temperatures as follows: the first step was denaturation at 94 °C for 3 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at different temperatures: 35 °C; 40 °C; 45 °C; 50 °C and 55 °C for 45 s, and elongation at 72 °C for 1 min with a final elongation at 72 °C for 10 min. The prepared reaction media were investigated by electrophoresis on a 1% agarose gel containing ethidium bromide. We needed between 30 to 50 ng of DNA in a total volume of 30 μl to achieve sequencing. The technological method was Sanger dideoxy sequencing.

2.4 In Situ Hybridization (ISH)

For in situ probe generation, we made a PCR amplification of template cDNA. Primers selected to get labeled riboprobes were the same as for RT-PCR, but were associated with Dig-labeled probes: DjFoxG forward: 5’-taatacgactcactatagggTTGATAATGATGGCAATTCG-3; DjFoxG reverse: 5’-atttaggtgacactatagTTAATTTGCCTGTTGTTCC-3’; DjPC2 forward: 5’-taatacgactcactatagggACACTGGACAAGCTGATGGA-3’; DjPC2 reverse: 5’-atttaggtgacactatagAACGCCCTCTACAATTGCAC-3’; DjotxA forward: 5′-atttaggtgacactatag GCAGTTGTTATGTAGCTGGCA; DjotxA reverse: 5′-taatacgactcactataggg CGTGTTGATGCTGATGTCGA; Cathepsin-D forward: 5’-aattaggtgacactatagAAGAAGAAAATTGCGCCCAG-3’; Cathepsin-D reverse: 5’-taatacgactcactatagggACACTGGACAAGCTGATGGA-3’. To synthesize RNA probes in vitro, we used T7 polymerase and Digoxigenin (Dig) labeling reagents. For Dig-labeling, we needed a total volume of 11 μl; we used 1 μg of purified template DNA, 2 μl of 10x NTP Dig, 4 μl of 5× transcription buffer for T7 (Kpnl), 1 μl of Protector RNase inhibitor (R1 Ribolock), and finally 2 μl of T7 polymerase. After mixing gently and centrifuging briefly, we incubated the solution for 2 h at 37 °C. Then we added 1 μl of DNase 1 and 1 μl DNAse buffer to remove the template DNA. This mixture was incubated for 15 min at 37 °C, and finally we stopped the reaction by adding 2 μl of 0.2 M EDTA. After purification by RNeasy Kit (Qiagen), we added 25 μl of nuclease-free water and measured the RNA concentration.

In situ hybridization (ISH) was performed as mentioned previously [19]. We selected intact (not regenerating) s1 and s2 Dsicula specimens; they were starved for one week before ISH inauguration. Briefly, in a first step, we used 2%HCL/5/8 Holtfreter, Canoy, MetOH, and 5%H2O2/MetOH as solutions to remove mucus, fix, and bleach planarians. Animals were selected (same length and size) in 2 ml of each solution. Hybridization is performed on the second day after rehydration by decreasing volumes of EtOH/5/8/PBS, preheat hybridization using a TPBS solution, protease digestion using 20 μg of proteinase K in 1 ml of TPBS, post-fixation by 5/8 PBS, 4%PFA/5/8 Holtfreter and TEA (0.1 M), acetylation by acetic anhydride and PBST, and prehybridization by prehybridization-mix (–20 °C) [20]. On day 3, posthybridization (washing) was carried out using decreasing volumes of formaldehyde (CH2O), then 2x SSC/0.1% Triton-X, Buffer I (malic acid buffer, Triton 10%, and H2O) and Buffer II (Buffer I, horse serum). For anti-body incubation, we added 1:2000 anti-DIG/Buffer II for 2 h, then washed planarians by Buffer I, keeping them overnight. On the last day, the color reaction take place in the dark, employing Buffer I, TMN, and 20 μl of NBT/BCIP ml TMN. To fix the color reaction, we used 1× PBS, 4%PFA/PBS, increasing then decreasing volumes of EtOH/PBS successively. Images of ISH samples were observed using a Leica M165 FC stereomicroscope.

3 Results

3.1 Bioinformatic analysis

The Djaponica genome is phylogenetically closer to Dsicula than Smediterranea. The analyses were confirmed in silico by a ClustalX and Njplot software combination by drawing a phylogenetic tree (Annex 1). We downloaded DjFoxG, DjPC2, DjotxA and Cathepsin-D and genes nucleotide sequences of Djaponica to treat and deduce primers, by OLIGO7 data, among which we selected the best couple for each gene. The choice is fixed after performing several analyses using the same piece of software. The designed forward and reverse primers were stable and temperature conditions were optimal for all genes. We carried out the alignment (Fig. 1) of DjFoxG (Fig. 1a), DjPC2 (Fig. 1b), and Cathepsin-D (Fig. 1c) fragments, obtained from Dsicula, with selected partial sequences from Djaponica, by Clustalx and DNAMAN software combinations performance. We found similarity between the Dsicula and Djaponica selected sequences through the BLAST program too. The homology analyses achieved by the DNAMAN software for both species were close to those obtained by the BLAST program for both genes DjFoxG and DjPC2. Although there is a wide difference in Cathepsin-D genes homology results, the DNAMAN software shows about 53% between both species, whereas the BLAST program reveals 83% of homology. For the DjotxA gene, the PCR and RT-PCR reactions were not significant, so automatically it was not sequenced. The resulting PCR bands were sequenced and have been assigned under accession numbers in GenBank as displayed in Table 2. The accession numbers of their homologue sequences in Djaponica were mentioned in the same table.

Fig. 1

Alignment of sequences by the DNAMAN software in combination with clustalX, which also reveals the percentage of homology between Dugesia sicula and Dugesia japonica. The framed sequences correspond to fragments that we identified in Dsicula (upper line): DjFoxG (KC293795.1); DjPC2 (MG653524) and Cathepsin-D (MG653525). Alignment of DjFoxG amino acids fragments identified in Dsicula and already found in Djaponica (a). Alignment of DjPC2 fragments identified in Dug. sicula and downloaded sequence from GenBank corresponding to Dug. japonica (b). Alignment of Cathepsin-D sequences in these species (c).

Table 2

GenBank accession numbers of the submitted Dugesia sicula nucleotide fragments and of their homologues already identified in Dugesia japonica.

Table 2
GenBank accession numbers
Nucleotide sequences Dugesia sicula Dugesia japonica
DjFoxG KC293795 AB091061
DjPC2 MG653524 AK388877
Cathepsin-D MG653525 AK389015

3.2 Expression of the selected genes

The identified fragments were expressed by RT-PCR performance, except the DjotxA gene. The DjFoxG transcript had its highest expression under annealing at 35 °C, 40 °C and 45 °C, with a low expression at 50 °C and no expression at 55 °C. The DjPC2 transcript had high expression under all chosen annealing temperatures. The Cathepsin-D transcript had low expression, except under annealing at 45 °C. We note the absence of DjotxA bands in all revelations. Different annealing temperatures were adapted to select the best commune degree. For sequencing as for hybridization, the PCR cycling program was moderate, with a best annealing temperature (45 °C) for all performed genes. Electrophoresis analysis made on a 1% agarose gel of PCR reaction for sequencing reveals clear bands in expected size without nonspecific bands. We clean up the PCR product of DjFoxG, DjPC2, and Cathepsin-D with the Qiagen kit (Qiagen, Münster, Germany), then we measured their concentrations for sequencing; the final products have been treated to have an appropriate concentration of 50 ng. Even though there is no band for DjotxA, we tried anyway in situ hybridization. Contrary to what was expected in PCR amplification and sequencing results, ISH for DjFoxG gene provided a doubtful result for both specimens, despite the optimization conditions (Fig. 2), but significant results for DjotxA. Hybridizations for DjPC2 and Cathepsin-D were successfully revealed. In Fig. 3, the expression of DjPC2 in the brain was indicated by white arrows, whereas it was represented by green arrows in the pair of longitudinal nerve cords (VNC). Furthermore, the brain branches and cephalic ganglions were clearly stained, which explains that this neuropeptide plays an important role in this cerebral parts. These results prove the expression of DjPC2 in the central nervous system (CNS) of the Dsicula flatworm (Fig. 3). Otherwise, in situ hybridization results revealed that DjotxA is finally expressed (Fig. 4). For the s1 Dsicula specimen, DjotxA is clearly expressed in the visual cells, but is slightly stained in the brain (Fig. 4a) contrary to the s2 specimen, in which DjotxA was abundantly expressed on the cephalic ganglion (Fig. 4b). Cathepsin-D is expressed in the Dsicula gut (Fig. 5). Accurately, this ventral view shows a clear staining of the flatworm digestive system, specifically the anterior branch, posterior trunks and diverticulum of the gastrovascular cavity, except the pharynx and the mouth.

Fig. 2

Ventral view of s1 and s2 specimens of Dugesia sicula showing the in situ hybridization of DjFoxG. s1 was a bit labeled but results could not be crucial (a). Results were not significant for the s2 Dsicula specimen (b).

Fig. 3

Expression patterns of DjPC2 genes in Dugesia sicula s1 (a) and s2 (b) specimens. Ventral view of the in situ hybridization performance (a and b). DjPC2 expression was detected on the central nervous system of Dsicula. It was expressed on the head (white arrows) and the ventral-dorsal nerve cords (yellow arrows).

Fig. 4

Expression of DjotxA in Dugesia sicula. Specimen s1 shows significant results, and the visual cells were clearly labeled (black arrows); we can almost discern expression in the brain (a). Expression of DjotxA in the head of specimen s2 (cephalic ganglion) (b).

Fig. 5

Ventral view of the in situ hybridization revelation of the Cathepsin-D gene in s1 (a) and s2 (b) Dugesia sicula specimens. Expression of Cathepsin-D on the planarian's gut (a and b). Staining of the gastrovascular cavity in the anterior (red arrows) and posterior (blue arrows) parts of the flatworm with its diverticulum. Absence of staining in the pharynx (green arrow) and the mouth (orange arrow).

4 Discussion

The OLIGO7 database performs several analyses, which are essential to achieve the nucleotide sequences amplification selectively for best PCR results [17]. The primers size is usually between 20 and 30 nucleotides in order to ensure a sufficiently specific hybridization to RNA and cDNA sequences. They have to show the best possible complementarities with both ends of the amplified sequence, so several criteria must be considered: for example, starting with ensuring the primers specificity by avoiding the formation of binding sites and having minimum mismatches with all the sequences. Secondly, avoiding the pairing primers between each other (Duplex), and forming dimmers and hairpin loops that reduce the concentration of primers, by resulting secondary sites of fixation [21]. It is necessary that primers hybridize to the template cDNA under the same temperature conditions. Their stability is determined by the free energy ΔG (kcal/mol), which must be less negative, to avoid the fixation of primers on each other, and also to avoid their binding sites, bases mismatches, duplexes and hairpin formations [22]. Actually, we choose to amplify partial fragments from selected genes in order to get rid of ambiguous and stretched bases that ensure favorite conditions for the polymerase chain reaction. ClustalX, ensuring a progressive alignment, and the DNAMAN software for multiple sequence alignment, have been used to confirm the species phylogeny rapprochement and to know the percentage of homology [16,23,24].

After bioinformatic analysis, expression was performed. Our RT-PCR results showed expression of all studied genes in Dsicula as predicted, except DjotxA, but these results confirm its genetic rapprochement to Djaponica. In situ hybridization for DjFoxG gene were blurred, so we cannot confirm, in a detailed way, the regions where it is normally expressed. Planarians were intact and this gene is a factor of transcription, highly expressed during regeneration [25]; this could be the reason of ISH expression deficiency. Recent studies confirmed that DjFoxG is a neural gene implicated in brain formation and that it is expressed in the cephalic ganglia in planarians [26]. DjFoxG had an expression in the body also, a strong one in the mesenchyme between epithelial layer and gut [28]. Its homolog FoxG1 is a forkhead gene specifically expressed in the telencephalon and retinal precursor cells in vertebrates [27] as mice [28]. It is expressed during otocyst development in zebrafish and mammals [29]. Then, for DjPC2 (prohormone convertase 2), as previously demonstrated, it is a neuropeptide processing enzyme and it is known as a major neurotransmitter [10]. According to current research, it was expressed in the CNS during planarian regeneration [19]. The identified DjPC2 in planarians has a high similarity with other animals [30]. It is known as a regulator in hypothalamus centers of the Siberian hamster [31]. Its homolog in mammals, which is the PC2 gene, is expressed in the neuroendocrine tissue and it is responsible for neuropeptide proteolytic processing [32]. This gene mediates prohormones and proneuropeptides proteolytic maturation [33]. Only hybridization results for DjotxA were different between Dsicula species s1 collected from Joumin and s2 from Boussadia. This gene is normally expressed in both, brain and visual cells [7], and in a previous study it was restricted to a medial region of ganglia where they found the projection of the photoreceptor axons [34]. The Cathepsin-D gene was expressed as expected in Dsicula's gut. It was known that aspartyl protease (Cathepsin-D) is localized in the digestive vacuolar compartments [35]. Previous research [36] confirms that a proteolytic cascade of this enzyme is used by the Schistosoma mansori parasitic worm to degrade hemoglobin into amino acids. Moreover, aspartyl protease has a blood-feeding function in the gut. This enzyme could have an important function in regeneration processing in planarians, while it was present during the cell differentiation stage in Dtigrina [37]. Interestingly, Cathepsin-D is synthesized from the midintestinal gland in response to viral infection [38]; so it contributes possibly in pathogens elimination [39].

In conclusion, these results confirm the current phylogenetic hypothesis and add prospects for initiating more appropriate studies concerning the species Dsicula. Bioinformatics pieces of software were fundamental to carry out molecular analysis as they facilitate the understanding of expression processing. The winged helix transcription factor DjFoxG was expressed through the RT-PCR technique, but unfortunately in this study the in situ hybridization (ISH) performance was low, but it could be definitively guaranteed in the future if we use Dsicula planarians that are in the process of regeneration. RT-PCR and ISH performances had shown a high expression of DjPC2 and Cathepsin-D. The DjotxA expression noticed in our work was exactly in the same region, compared with the work by Umesono et al. (1999) [7], which was realized on Djaponica. According to the ISH performance of the central nervous system, digestive systems, visual and stem cells, it is clear that Dsicula specimens collected from different dams are anatomically slightly different, but are close to the species Djaponica, too [36,40]. We target a set of different genes because we believe that studying their expression in Dsicula is a basic, but useful work to carry out more developed research on this species and understand the function of some body regions, under well-defined biological conditions. Planarians have a remarkable regeneration processing ability and Dsicula could be a good model to extend molecular performance and enrich appropriate studies.

Acknowledgments

This work has been supported, in part, by a fellowship grant to Emna Meddeb, by recurrent funding from the Tunisian Ministry of Higher Education and Scientific Research.

We thank the Stem Cells and Regeneration Group (Max Planck Institute for Molecular Biomedicine, Münster, Germany) and Professor Alessandra Salvetti (University of Pisa, Italy) for help and technical support.

Appendix 1 Phylogenetic tree of COI mitochondrial genes corresponding to Dugesia sicula (DQ666035), Dugesia japonica (DQ666034), and Schmidtea mediterranea (AF178322) using Clustalx and NJPLOT combinations.


References

[1] E.M. Lázaro; M. Riutort Dugesia sicula (Platyhelminthes, Tricladida): the colonizing success of an asexual Planarian, BMC Evol. Biol., Volume 13 (2013), p. 268

[2] K. Agata Regeneration and gene regulation in planarians, Curr. Opin. Genet. Dev., Volume 13 (2003) no. 5, pp. 492-496 | DOI

[3] K.H. Kaestner; W. Knochel; D.E. Martínez Unified nomenclature for the winged helix/forkhead transcription factors, Genes Dev., Volume 14 (2000) no. 2, pp. 142-146 | DOI

[4] F. Cebria; T. Kudome; M. Nakazawa; K. Mineta; K.G. Ikeo; K. Agata The expression of neural-specific genes reveals the structural and molecular complexity of the planarian central nervous system, Mech. Dev., Volume 116 (2002) no. 1–2, pp. 199-204 | DOI

[5] T. Ouimet; A. Mammarbachib; T. Cloutier; N.G. Seidah; V.F. Castellucci cDNA structure and in situ localization of the Aplysia calzfornica pro-hormone convertase PC2, FEBS Lett., Volume 330 (1993) no. 3, pp. 343-346 | DOI

[6] N.G. Seidah; S. Benjannet; J. Hamelin; A.M. Mamarbachi; A. Basak; J. Marcinkiewicz; M. Mbikay; M. Chrétien; M. Marcinkiewicz The Subtilisin/Kexin Family of Precursor Convertases: Emphasis on PC1, PC2/7B2, POMC and the Novel Enzyme SKI-1, Ann. N.Y. Acad. Sci., Volume 885 (1999), pp. 57-74 | DOI

[7] Y. Umesono; K. Watanabe; K. Agata Distinct structural domains in the planarian brain defined by the expression of evolutionarily conserved homeobox genes, Dev. Genes Evol., Volume 209 (1999), pp. 31-39 | DOI

[8] P.J. Brindley; B.H. Kalinna; J.Y.M. Wong; B.J. Bogitsh; L.T. King; D.J. Smyth; C.K. Verity; G. Abbenante; R.I. Brinkworth; D.P. Fairlie; M.L. Smythe; P.J. Milburn; H. Bielefeldt-Ohmann; Y. Zheng; D.P. McManus Proteolysis of human hemoglobin by schistosome cathepsin D, Mol. Biochem. Parasitol., Volume 112 (2001) no. 1, pp. 103-112 | DOI

[9] L.S. Goupil; S.L. Ivry; I. Hsieh; B.M. Suzuki; C.S. Craik; A.J. O’Donoghue; J.H. McKerrow Cysteine and Aspartyl Proteases Contribute to Protein Digestion in the Gut of Freshwater Planaria, PLoS Negl. Trop. Dis., Volume 10 (2016) no. 8, p. e0004893 | DOI

[10] M. Charni; A.H. Harrath; R. Sluys; S. Tekaya; F. Zghal The freshwater planarian Dugesia sicula Lepori, 1948 (Platyhelminthes, Tricladida) in Tunisia: ecology, karyology, and morphology, Hydrobiologia, Volume 517 (2004) no. 1–3, pp. 161-170 | DOI

[11] E. Meddeb; M. Charni; T. Ghazouani; A. Cozzolino; F. Fratianni; F. Raboudi; F. Nazzaro; S. Fattouch Biochemical and Molecular Study of Carpobrotus edulis Bioactive Properties and Their Effects on Dugesia sicula (Turbellaria, Tricladida) Regeneration, Appl. Biochem. Biotechnol., Volume 182 (2017) no. 3, pp. 1131-1143 | DOI

[12] M.D. Molina; E. Saló; F. Cebrià The BMP pathway is essential for respecification and maintenance of the dorsoventral axis in regenerating and intact planarians, Dev. Biol., Volume 311 (2007) no. 1, pp. 79-94 | DOI

[13] P.M. Alvarez; J. Baguna; M. Riutort Molecular phylogeny of land and freshwater planarians (Tricladida, Platyhelminthes): From freshwater to land and back, Mol. Phylogenet. Evol., Volume 47 (2008) no. 2, pp. 555-568 | DOI

[14] M. McKenzie; M. Chiotis; C.A. Pinkert; I.A. Trounce Functional Respiratory Chain Analyses in Murid Xenomitochondrial Cybrids Expose Coevolutionary Constraints of Cytochrome b and Nuclear Subunits of Complex III, Mol. Biol. Evol., Volume 20 (2003) no. 7, pp. 1117-1124 | DOI

[15] R. Du; R. Du; Y.F. Chen; X.R. An; X.Y. Yang; Y. Ma; L. Zhang; X.L. Yuan; L.M. Chen; J. Qin Cloning and sequence analysis of myostatin promoter in sheep, DNA Seq., Volume 16 (2009) no. 6, pp. 412-417 | DOI

[16] H. Yin; X. Zhao; Y.G. Du Cloning and Molecular Characterization of a SKP1 Gene from Brassica napus, Proc. 3rd International Conference on Bioinformatics and Biomedical Engineering, iCBBE, 2009, p. 2009 | DOI

[17] W. Rychlik OLIGO 7 Primer Analysis Software, In: Yuryev A. (ed.), PCR Primer Design, Methods Mol. Biol., Volume 402 (2007), pp. 35-59 | DOI

[18] T. Sandmann; M.C. Vogg; S. Owlarn; M. Boutros; K. Bartscherer The head-regeneration transcriptome of the planarian Schmidtea mediterranea, Genome Biol., Volume 12 (2011) no. 8, p. R76 | DOI

[19] T. Nogi; M. Levin Characterization of innexin gene expression and functional roles of gap-junctional communication in planarian regeneration, Dev. Biol., Volume 287 (2005) no. 2, pp. 314-335 | DOI

[20] M. März; F. Seebeck; K. Bartscherer A Pitx transcription factor controls the establishment and maintenance of the serotonergic lineage in planarians, Development, Volume 140 (2013) no. 22, pp. 4499-4509 | DOI

[21] O. Croce; F. Chevenet; C.R. Richard OligoHeatMap (OHM): an online tool to estimate and display hybridizations of oligonucleotides onto DNA sequences, Nucleic Acids Res., Volume 36 (2008) no. 2, pp. 154-156 | DOI

[22] G.E. Tusnády; I. Simon; A. Váradi; T. Arányi; BiSearch: primer-design and search tool for PCR on bisulfite-treated genomes, Nucleic Acids Res., Volume 33 (2005) no. 1, p. e9 | DOI

[23] S. Iliyas; F.S. Sarkhawas A Comparative Study of MSA Tools Based on Sequence Alignment Features and Platform Independency to Select the Appropriate Tool Desired, Allana Institute of Management Sciences, Pune, India (2011)

[24] P. Yin; J. Yan; R. Niu; C. Chen; J. Wang; J. Tan Bioinformatics, Analysis of Chalconesynthase Gene in Morus, Agric. Sci. Technol., Volume 14 (2013) no. 9, pp. 1209-2011

[25] S. Koinuma; Y. Umesono; K. Watanabe; K. Agata The expression of planarian brain factor homologs, DjFoxG and DjFoxD, Gene Expr. Patterns, Volume 3 (2003) no. 1, pp. 21-27 | DOI

[26] Z. Yuan; J. Zhang; B. Zhao; Z. Miao; X. Wu Effects of perfluorooctanoic acid on neural genes expression and neuronal morphology in the planarian Dugesia japonica, Chem. Ecol., Volume 32 (2016) no. 6, pp. 575-582 | DOI

[27] H.E. Moose; L.E. Kelly; S. Nekkalapudi; H.M. El-Hodiri Ocular forkhead transcription factors: seeing eye to eye, Int. J. Dev. Biol., Volume 53 (2009) no. 1, pp. 29-36 | DOI

[28] J.M. Hébert; S.K. McConnell Targeting of cre to the Foxg1 (BF-1) Locus Mediates loxP Recombination in the Telencephalon and Other Developing Head Structures, Dev. Biol., Volume 222 (2000) no. 2, pp. 296-306 | DOI

[29] S. Pauley; E. Lai; B. Fritzsch Foxg1 is required for morphogenesis and histogenesis of the mammalian inner ear, Dev. Dyn., Volume 235 (2006) no. 9, pp. 2470-2482 | DOI

[30] K. Agata; Y. Soejima; K. Kato; C. Kobayashi; Y. Umesono; K. Watanabe Structure of the planarian central nervous system (CNS) revealed by neuronal cell markers, Zool. Sci., Volume 15 (1998) no. 3, pp. 433-440 | DOI

[31] M. Helwig; R.M.H. Khooroshi; A. Tups; P. Barrett; Z.A. Archer; C. Exner; J. Rozman; L.J. Braulke; J.G. Mercer; M. Klingenspor PC1/3 and PC2 Gene Expression and Post-Translational Endoproteolytic Pro-Opiomelanocortin Processing is Regulated by Photoperiod in the Seasonal Siberian Hamster (Phodopus sungorus), J. Neuroendocrinol., Volume 18 (2006) no. 6, pp. 413-425 | DOI

[32] S. Tanaka Comparative Aspects of Intracellular Proteolytic Processing of Peptide Hormone Precursors: Studies of Proopiomelanocortin Processing, Zool. Sci., Volume 20 (2003) no. 10, pp. 1183-1198 | DOI

[33] M. Mbikay; M.L. Raffin-Sanson; F. Sirois; L. Kalenga; M. Chretien; N.G. Seidah Characterization of a repressor element in the promoter region of proprotein convertase 2 (PC2) gene, Mol. Brain Res., Volume 102 (2002) no. 1–2, pp. 35-47 | DOI

[34] E. Salò; D. Pineda; M. Marsal; J. Gonzalez; V. Gremigni; R. Batistoni Genetic network of the eye in Platyhelminthes: expression and functional analysis of some players during planarian regeneration, Gene, Volume 287 (2001) no. 1–2, pp. 67-74 https://www.sciencedirect.com/science/article/pii/S0378111901008630

[35] B.J. Bogitsh; K.F. Krischner Schistosoma japonicum: Ultrastructural localization of an hemoglobinase using mercury labeled pepstatin, Exp. Parasitol., Volume 62 (1986) no. 2, pp. 211-215 | DOI

[36] P.L. Faust; S. Kornfeld; J.M. Chirgwin Cloning and sequence analysis of cDNA for human cathepsin D, Proc. Natl. Acad. Sci. USA, Volume 82 (1985) no. 15, pp. 4910-4914

[37] F.B. Zamora-Veyl; H.L.M. Guedes; S. Giovanni-De-Simone Aspartic Proteinase in Dugesia tigrina (Girard) Planaria, Z. Naturforsch. C, Volume 57 (2002) no. 5–6, pp. 541-547

[38] T. Rőszer The invertebrate midintestinal gland (“hepatopancreas”) is an evolutionary forerunner in the integration of immunity and metabolism, Cell Tissue Res., Volume 358 (2014) no. 3, pp. 685-695 | DOI

[39] A. Venugopal; S.N. Kumar Biochemical characterization of cathepsin D from the mussel Lamellidens corrianus, Comp. Biochem. Physiol. B, Volume 169 (2014), pp. 25-30 | DOI

[40] Y. Umesono; K. Agata Evolution and regeneration of the planarian central nervous system, Dev. Growth Differ., Volume 51 (2009) no. 3, pp. 185-195 | DOI


Comments - Policy