Outline
Comptes Rendus

Ecology / Écologie
Molecular phylogeny in mytilids supports the wooden steps to deep-sea vents hypothesis
Comptes Rendus. Biologies, Volume 330 (2007) no. 5, pp. 446-456

Abstracts

Molecular data were used to study the diversity of mytilids associated with sunken-woods sampled in the Solomon Islands and discuss the ‘wooden steps to deep-sea vent’ hypothesis proposed by Distel et al. First, COI data used in a barcoding approach confirm the presence of four distinct species. Analyses of the 18S rDNA and COI dataset then confirmed that these sunken-wood mytilids belonged to a monophyletic group including all species from deep-sea reducing environments. Finally, we analyzed the relationships within this monophyletic group that include the Bathymodiolinae using a COI dataset and a combined analysis of mitochondrial COI and ND4 genes and nuclear rDNA 18S and 28S. Our study supported the ‘wooden steps to deep-sea vent’ hypothesis: one of the sunken-wood species had a basal position within the Bathymodiolionae, and all described vent and seep mussels included in our analyses were derived taxa within Bathymodiolinae.

La diversité des mytilidés associés aux bois coulés échantillonnés aux îles Salomon a été étudiée avec des données moléculaires, afin de discuter l'hypothèse selon laquelle les « bois coulés » ont pu être des étapes évolutives dans la colonisation des sources hydrothermales. Premièrement, une approche « barcode–ADN », utilisant le gène COI, confirme la présence de quatre espèces. Les analyses des gènes 18S et COI confirment l'appartenance de ces mytilidés, associés aux bois coulés, au groupe monophylétique regroupant les mytilidés des milieux réducteurs profonds. Enfin, nous analysons les relations au sein de ce groupe monophylétique, en utilisant le gène COI seul, puis dans une analyse combinée avec trois autres gènes (ND4, 18S et 28S). Notre étude soutient l'hypothèse de la colonisation des sources hydrothermales profondes à partir d'étapes « bois coulés »: une des espèces associées aux bois coulés a une position basale, et toutes les espèces provenant des sources hydrothermales et suintements froids, pour lesquelles les données étaient disponibles, apparaissent comme dérivées.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2007.04.001
Keywords: Bathymodiolinae, DNA barcode, Hydrothermal vents, Molecular phylogeny, Mytilids, Sunken woods
Mots-clés : Barcode ADN, Bathymodiolinae, Bois coulés, Mytilidés, Phylogénie moléculaire, Sources hydrothermales

Sarah Samadi  1 ; Erwan Quéméré  1 ; Julien Lorion  1 ; Annie Tillier  2 ; Rudo von Cosel  3 ; Philippe Lopez  1 ; Corinne Cruaud  4 ; Arnaud Couloux  4 ; Marie-Catherine Boisselier-Dubayle  1

1 ‘Systématique, adaptation et évolution’, UMR 7138 UPMC–IRD–MNHN–CNRS (UR IRD 148), département ‘Systématique et évolution’, Muséum national d'histoire naturelle, CP 26, 57, rue Cuvier, 75231 Paris cedex 05, France
2 Service de systématique moléculaire (CNRS, IFR101), département ‘Systématique et évolution’, Muséum national d'histoire naturelle, CP 26, 57, rue Cuvier, 75231 Paris cedex 05, France
3 Taxonomie–Collections USM 602 / UMS CNRS 2700, département ‘Systématique et évolution’, Muséum national d'histoire naturelle, CP 51, 55, rue Buffon, 75231 Paris cedex 05, France
4 GENOSCOPE, Centre national de séquençage, 2, rue Gaston-Crémieux, CP 5706, 91057 Évry cedex, France
@article{CRBIOL_2007__330_5_446_0,
     author = {Sarah Samadi and Erwan Qu\'em\'er\'e and Julien Lorion and Annie Tillier and Rudo von Cosel and Philippe Lopez and Corinne Cruaud and Arnaud Couloux and Marie-Catherine Boisselier-Dubayle},
     title = {Molecular phylogeny in mytilids supports the wooden steps to deep-sea vents hypothesis},
     journal = {Comptes Rendus. Biologies},
     pages = {446--456},
     year = {2007},
     publisher = {Elsevier},
     volume = {330},
     number = {5},
     doi = {10.1016/j.crvi.2007.04.001},
     language = {en},
}
TY  - JOUR
AU  - Sarah Samadi
AU  - Erwan Quéméré
AU  - Julien Lorion
AU  - Annie Tillier
AU  - Rudo von Cosel
AU  - Philippe Lopez
AU  - Corinne Cruaud
AU  - Arnaud Couloux
AU  - Marie-Catherine Boisselier-Dubayle
TI  - Molecular phylogeny in mytilids supports the wooden steps to deep-sea vents hypothesis
JO  - Comptes Rendus. Biologies
PY  - 2007
SP  - 446
EP  - 456
VL  - 330
IS  - 5
PB  - Elsevier
DO  - 10.1016/j.crvi.2007.04.001
LA  - en
ID  - CRBIOL_2007__330_5_446_0
ER  - 
%0 Journal Article
%A Sarah Samadi
%A Erwan Quéméré
%A Julien Lorion
%A Annie Tillier
%A Rudo von Cosel
%A Philippe Lopez
%A Corinne Cruaud
%A Arnaud Couloux
%A Marie-Catherine Boisselier-Dubayle
%T Molecular phylogeny in mytilids supports the wooden steps to deep-sea vents hypothesis
%J Comptes Rendus. Biologies
%D 2007
%P 446-456
%V 330
%N 5
%I Elsevier
%R 10.1016/j.crvi.2007.04.001
%G en
%F CRBIOL_2007__330_5_446_0
Sarah Samadi; Erwan Quéméré; Julien Lorion; Annie Tillier; Rudo von Cosel; Philippe Lopez; Corinne Cruaud; Arnaud Couloux; Marie-Catherine Boisselier-Dubayle. Molecular phylogeny in mytilids supports the wooden steps to deep-sea vents hypothesis. Comptes Rendus. Biologies, Volume 330 (2007) no. 5, pp. 446-456. doi: 10.1016/j.crvi.2007.04.001

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

Deep-sea vent and seep animals communities have been thoroughly studied since they were discovered about 30 years ago. Initially, it was suggested that these animals were ‘living fossils’ [1], but combinations of fossil and molecular data indicate that most modern vent animal groups arose relatively recently [2]. Recent studies [3–6] underlined the ecological and zoological affinities of organisms associated with sunken woods with organisms associated with cold seeps, hydrothermal vents and whale falls. Indeed, the organic substrata of vegetal origin (wood, leaves, seeds, nuts) that accumulate in sedimentation basins or in estuaries, at depths beyond the penetration limit of sunlight, host an original but poorly studied fauna. Although insufficiently documented, it has been suggested that these communities, like hydrothermal or cold seep ones, would depend on chemoautotrophic bacteria [7].

The purpose of the present study is to discuss the ‘wooden steps to deep-sea vent’ hypothesis proposed by [3,4] for mytilids associated with deep-sea reducing environments, using datasets that include more species associated with sunken woods. These authors showed that all bivalve molluscs of the subfamily Bathymodiolinae [8] associated with seeps and vents, together with other mytilids associated with sunken woods and bones, form a monophyletic group and that within this clade one species, associated with sunken wood, had a basal position. From these results, they hypothesized that “decomposing wood and bone may have served as ‘steps’ for the introduction of mytilid taxa to vent and seeps.” However, although the results of [4] suggested that Bathymodiolinae species associated with organic substrata must be included into the dataset in order to better understand the evolutionary origins of vents' fauna, more recent phylogenetic studies are always biased toward vent and seep species [9,10]. To reduce this taxonomic bias, we present here an analysis of the molecular diversity of mytilids associated with sunken woods sampled in the Solomon Islands.

As the taxonomy of sunken wood mussels is poorly known, we first delimited the terminal taxa using the diversity of the fragment of COI gene as suggested in the ‘Barcoding of Life’ project [11]. Second, we explored the 18S rDNA dataset to confirm that the sunken woods mytilids of the Solomon Islands belonged to the monophyletic group identified by [4]. Third, we needed to determine which was the best outgroup to use in order to analyze the relationships within the monophyletic group that includes the Bathymodiolinae. Indeed, the relationships between mytilid subfamilies were not completely resolved with the 18S rDNA [12] and are still under discussion. Indeed, Chichvarkhin [13], using several morphological analyses [14,15] and fossil records [16], have proposed alternative hypotheses to that proposed by [4,12]. Thus, to determine which outgroup to use to study the relationships within Bathymodiolinae, we added the phylogenetic analysis of mytilids using the COI gene. Finally, we analyzed the relationships within the monophyletic group that included the Bathymodiolinae, first by using the diversity of COI, then by adding, for each terminal taxon – identified with the COI gene –, a portion of the mitochondrial gene ND4 and a portion of the nuclear genes 18S and 28S rDNA, two genes used by [5,9].

2 Materials and methods

2.1 Sampling

Mytilids associated with sunken plant materials (wood, seeds, nuts, etc.) were collected at 100–1200-m depth during the Salomon 2 cruise with R/V Alis in October 2004. A list of stations and localities is available at www.tropicaldeepseabenthos.org. Based on the morphology of the shell, Rudo von Cosel grouped the specimens into four morphospecies. For each morphospecies, we used three to eight individuals in the molecular analyses (Table 1). Overall, 22 individuals covering the morphological diversity of the sampling, as well as the explored depth and geographical ranges, were analyzed.

Table 1

List of specimens sampled during the Salomon2 cruise in the Solomon Islands and sequenced for the gene COI, ND4, 18S, and 28S genes

Species Morphotype/Phylotype Specimen label GenBank N° Habitat
18S 28S COI ND4
Idas sp. SAL-1 Rva DQ340795 DQ340775 sunken wood
RVe DQ340778 sunken wood
RVh DQ340780 sunken wood
SIb DQ340782 sunken wood
TLa DQ340794 DQ340785 sunken wood
TRa DQ340787 sunken wood
VGc DQ863944 DQ340790 DQ863951 sunken wood
Adipicola longissima SAL-2 CHb DQ340773 sunken wood
RVd DQ340799 DQ340777 sunken wood
SId DQ340784 sunken wood
SIc DQ340783 sunken wood
VGb DQ863945 DQ340789 DQ863950 sunken wood
VLb DQ340791 sunken wood
VLc DQ340792 sunken wood
VGa DQ340798 DQ340788 sunken wood
Idas sp. SAL-3 CHa DQ340801 DQ340772 sunken wood
CHc DQ863946 DQ340774 DQ863949 sunken wood
SIa DQ340800 DQ340781 sunken wood
Idas sp. SAL-4 RVb DQ340796 DQ340776 sunken wood
RVc DQ340797 DQ340793 sunken wood
RVg DQ863947 DQ340779 DQ863948 sunken wood
TLb DQ340786 sunken wood

2.2 Molecular methods

DNA was extracted from mussel tissues, avoiding the gills, which may contain many associated organisms, such as symbiotic bacteria. We used the ABI PRISM 6100 (Applied Biosystem) extraction and purification station. The Cytochrome Oxidase I (COI) mitochondrial gene was amplified for all the selected specimens using universal primers LCO 1490 and HCO 2198 developed by [17]. Then, one specimen for each identified terminal taxon was amplified for NADH dehydrogenase subunit 4 (ND4) mitochondrial gene using primers ArgBl and NAP2H [18,19], as well as a fragment of 18S rDNA nuclear gene using universal primers 18S1F, 18SBi, 18S5F, and 18S9R [12], and domains D1, D2 et D3 [20] of 28S rDNA nuclear gene using primers C1′(5′ACCCGCTGAATTTAAGCAT3′) and C4(5′TCGGAGGGAACCAGCTACTA3′).

PCR reactions were performed in a 25-μL final volume, containing approximately 3 ng template DNA, 1.5 mM MgCl2, 0.26 mM of each nucleotide, 0.3 μM of each primer, 5% DMSO and 0.75 unit of Taq Polymerase (Qbiogene). Amplification products were generated by an initial denaturing step of 4 min at 94 °C followed by 35 cycles (for COI, 28S and ND4)/37 cycles (for 18S) at 94 °C for 1 min, 50 °C for 1 min and 1 min at 72 °C, and by a final extension at 72 °C for 7 min. PCR products were purified using TM PCR Centrifugal Filter Devices (Millipore) and sequenced [21] on a Ceq2000TM automated sequencer (Beckman) for COI and at the Genoscope (Évry, France) for 18S, 28S and ND4, in both directions to confirm the accuracy of each sequence.

2.3 Molecular divergence among morphospecies

We used the same part of the COI gene as proposed by [11] for the Barcoding approach. Nucleotide-sequence divergences were calculated using the Kimura-two-parameter (K2P) model, which is suggested to be the best metric when distances are low [22]. In order to evaluate the species delineations, we compared genetic distances within morphospecies versus between morphospecies. We also used the neighbour-joining (NJ) analysis, implemented in MEGA 3 [23], to determine if haplotypes of each morphospecies were more closely related to each other than with haplotypes from other morphospecies.

2.4 Phylogenetic analyses

Phylogenetic relationships were estimated using three methods. First, we conducted an equally weighted maximum-parsimony (MP) research with a heuristic search option with 1000 random taxon-addition (RA) replicates and tree bisection and reconnection (TBR) branch-swapping using PAUP* v4.0b10 [24]. Second, the best fitting model of the sequence evolution for the maximum-likelihood (ML) analyses was determined by hierarchical likelihood ratio tests (hLTR) implemented in Modeltest version 3.06 [25]. The parameters estimated for the best-fit sequence evolution model were used in the ML heuristic searches with 100 RA replicates with TBR branch swapping using PHYML 2.4.4 [26]. For both MP and ML analyses, robustness of the nodes was assessed with nonparametric bootstrapping [27] with 1000 bootstrap replicates, TBR branch-swapping, and 10 RA replicates. Third, Bayesian analyses (BA) were performed with MrBayes v3.0 [28]. Six Markov chains were run in two parallel analyses using the parameters of the model used in the ML searches. Each Markov chain was run for 6 000 000 generations with a sampling frequency of one tree every hundred generations and a burning period of 15 000 trees. Convergence between the two analyses was assessed using likelihood curves, standard deviation of split frequencies, and potential scale-reduction factor (PSRF), as indicated by some authors [28,29]. All Bayesian analyses were performed on the cluster developed at the MNHN (17 nodes, 2-Go RAM per node, 30 AMDs 64 bits CPU's for the slave nodes and 4 Xeon 32 bits CPUs for the two master nodes).

The phylogenetic analyses were first performed on the RNAr 18S matrix constituted of a subset of eight specimens representative of the four identified morphospecies (Table 1) and of the sequences used in [4,9,12,30] (Tables 2 and 3).

Table 2

List of Bathymodiolinae species used in this study and available from GenBank

Species GenBank N° Habitat
18S 28S COI ND4
Bathymodiolus heckerae BR AY649830 AY781139 AY649793 AY130245 seep
Bathymodiolus heckerae WFE AF221639 AY781138 AY649794 AY130246 seep
Bathymodiolus azoricus AY649822 AY781148 AY649795 AF128534 vent
Bathymodiolus puteoserpentis AF221640 AY781151 AY649796 AF128533 vent
Bathymodiolus brooksi AC AY649826 AY781136 AY649797 AY130247 seep
Bathymodiolus brooksi WFE AY649825 AY781135 AY649798 AY649805 seep
Bathymodiolus brevior MT AY649824 AY781150 AY649799 AY649806 vent
Bathymodiolus brevior LBA AY649827 AY781143 AY275544 AY046277 vent
Bathymodiolus marisindicus AY649818 AY781147 AY275543 AY046279 vent
Bathymodiolus thermophilus A AF221638 AY781141 AF456285 AY649807 vent
Bathymodiolus thermophilus B AY649829 AY781142 AF456303 AY649808 vent
Bathymodiolus aff. thermophilus AY649823 AY781140 AF456317 AY649809 vent
Bathymodiolus childressi AF221641 AY781137 AY649800 AY130248 seep
Bathymodiolus mauritanicus AY649828 AY781144 AY649801 AY649810 seep
Gigantidas gladius AY649821 AY781149 AY649802 AY649813 vent
Bathymodiolus tangaroa AY649820 AY781134 AY608439 AY649811 seep
Tamu fisheri AF221642 AY781132 AY649803 AY649814 seep
Idas washingtonia AF221645 AY781146 AY275546 AY649815 whale bones, wood
Idas macdonaldi AF221647 AY781145 AY649804 AY649816 seep
NZ3 AY649819 AY781133 AY608440 AY649812 vent
Myrina pacifica AF221646 whale bones
Idas arcuatilis AF221643 whale bones
Adipicola arcuatalis AF221644 whale bones
Table 3

List of Mytilidae (except Bathymodiolinae) and Bivalvia outgroups used in this study

Subclass Family Sub-family Species GenBank N°
18S 28S COI ND4
Pteriomorpha Mytilidae Crenellinae Musculista senhousia AF124207 AB076942
Crenellinae Musculus discors AF124206
Lithophaginae Lithophaga nigra AF124209
Lithophaginae Lithophaga lithophaga AF124208 AF120644
Modiolinae Benthomodiolus lignicola AF221648 AY781131 AY275545 AY649817
Modiolinae Geukensia demissa L33450 AY621926
Modiolinae Modiolus auriculatus AF117735
Modiolinae Modiolus modiolus EF526454 EF526455 U56848 EF526453
Modiolinae Myrina pacifica AF221646
Mytilinae Perna viridis AF298852
Mytilinae Brachidontes modiolus AY621918
Mytilinae Brachidontes exustus AF229623
Mytilinae Hormomya exustus AY621945
Mytilinae Hormomya domingensis AF117736
Mytilinae Ischadium recurvum AY621929
Mytilinae Mytilus galloprovincialis L33451
Mytilinae Mytilus trossulus L33453
Mytilinae Mytilus californianus L33449
Mytilinae Mytilus edulis L24489 AY377727
Mytilinae Trichomya hirsuta AY296816
Dacrydiinae Dacrydium zebra AB076945
Ostreidae Crassostrea virginica X60315
Ostreidae Ostrea edulis U88709 AF120651
Pinnidae Atrina pectinata X90961 AB076914
Arcidae Arca noae X90960
Arcidae Glycymeris sp X91978
Arcidae Barbatia virescens X91974
Pectinidae Chlamys islandica L11232
Pectinidae Placopecten magellanicus X53899
Paleoheterodonta Unionidae Elliptio complanata AF117738
Heterodonta Myidae Mya arenaria AF117739
Protobranchia Solemyidae Solemya reidi AF117737
Solemyidae Solemya velum AF120524 U56852

Then, as there was no consensus on the relationships between Mytilids subfamilies (see [13]), we analyzed the relationships of the subfamily Bathymodiolinae with other subfamilies of Mytilidae (Rafinesque, 1815). For that purpose, we used COI data from GenBank to determine which taxa were the more closely related to the bathymodiolin group in order to use them as outgroups in the study of the relationships within this group. We included in this analysis one sequence from each one of our morphospecies and one to five sequences for each Mytilid subfamily. In this analysis, we only used the first and second codon positions of the COI gene, because the third position of this gene was saturated.

The outgroups identified by this analysis were subsequently used in the analysis of the COI matrix, including the GenBank sequences from [9,31], attributed to Bathymodiolinae (Table 2), and our own sequences of sunken wood mytilids from the Solomon Islands.

Finally, we sequenced two other genes (ND4 and rDNA 28S genes) used by [5,9] to improve our phylogenetic analyses. For that purpose, one sequence of each one of these two genes was used for each morphospecies validated by the analysis of COI diversity (Table 1). We first explored separately each one of the four single gene datasets by the maximum-likelihood approach and performed an incongruence length difference (ILD) test [32] in order to validate congruence between all genes. Mitochondrial dataset analyses were first performed using the whole dataset (i.e. the three positions of each codon). As Jones et al. [9] suggested that these genes are saturated at the third codon position among Bathymodiolinae, each mitochondrial dataset was also analyzed without this position. Then, taking into account the results of the effect of the saturation of the third position, we performed a combined Bayesian analysis for which the number of substitution types of each gene-specific model, as defined using Modeltest 3.06, was implemented.

3 Results

3.1 The diversity of sunken wood mussels from Solomon Islands

Analysis of the COI gene yielded four distinct haplotype clusters in the NJ tree (i.e. phylotypes, figure not shown). These phylotypes were separated by large genetic distances (ranging from 15.1% to 19.2%), whereas the genetic distances within phylotypes were not higher than 1.5% (Table 4). There was no overlap between the ranges of intra-phylotypic and inter-phylotypic genetic distances. Moreover, the NJ tree indicated that haplotypes obtained for each morphospecies were in the same phylotype and thus that within a morphospecies, haplotypes were more closely related to each other than to haplotypes obtained for other morphospecies. These four phylotypes were consistent with the morphospecies delimitation that was a priori defined looking at the global morphology of the shells (named SAL-1 to SAL-4).

Table 4

Matrix of genetic distance (K2P) within and between phylotypes. Standard errors are in brackets

SAL-1 SAL-2 SAL-3 SAL-4
SAL-1 0.013 (0.003)
SAL-2 0.157 (0.018) 0.003 (0.002)
SAL-3 0.180 (0.018) 0.157 (0.004) 0.001 (0.001)
SAL-4 0.186 (0.018) 0.151 (0.016) 0.192 (0.018) 0.015 (0.004)

3.2 Phylogenetic analyses

Whatever the phylogenetic reconstruction method used, all specimens sequenced for the rRNA 18S gene belong to a monophyletic group that includes all other mussels associated with reducing environments (Fig. 1). However, as shown by [4,12], the low variability of this gene at this level did not allow one to further elucidate the relationships.

Fig. 1

Phylogenetic relationships among mytilids (18S gene) determined using the Bayesian approach. Maximum likelihood was calculated using TrNef+[Γ]+I with I=0.5978, [Γ]=0.7230, and equal frequencies of nucleotides (−lnL=5324.5322; K=4). Bootstrap proportions and Bayesian posterior probabilities were presented at nodes. Nodes for which posterior probabilities were below 0.95 and/or bootstrap value below 80% were collapsed.

The variability of the first and second positions of the COI gene allowed us to resolve the phylogenetic relationships within mytilids. The same relationships were obtained with the three reconstructions methods (Fig. 2). These analyses suggested that mytilids are divided into two major and well-supported lineages. (i) One of these lineages included Lithophaga lithophaga and Dacrydium zebra at the base of two resolved clades. One of these clades included the species Trichomya hirsuta, Musculista senhousia, Mytilus edulis, and Perna viridis, and the other clade regrouped the species Ischadium recurvum, Geukensia demissa, Brachidontes exustus and Hormomya domingensis. These two clades both include species attributed to Mytilinae and thus make this sub-family polyphyletic. (ii) The second lineage regrouped all the Bathymodiolinae, including our Solomon Islands' sunken woods morphospecies. This result confirmed that our sunken wood mussels belong to Bathymodiolinae. This lineage displayed Modiolus modiolus (Linnaeus, 1758) in the most basal position immediately followed by Benthomodiolus lignicola (Dell, 1987), indicating that these two shallow water mussels are the closest relatives to Bathymodiolinae. These two species were subsequently used as outgroups in our analysis of the relationships within Bathymodiolinae.

Fig. 2

Phylogenetic relationships among mytilids (COI gene) determined using the maximum-likelihood method. Likelihood substitution model: HKY-85+[Γ]+I with [α]=0.449 and base frequencies and ti:tv (4.675) estimated from the data. Bootstrap proportions for parsimony (upper) and ML (middle) analysis are presented (percentage of 1000 replicates). Dashes are values <50%. Bayesian posterior clade probabilities (bottom) are presented (consensus of 50 000 trees).

The latter analysis was conducted on COI data of all our specimens together with available Bathymodiolinae sequences from GenBank (Table 2), using M. modiolus and Be. lignicola as outgroups. The Bayesian analysis of this matrix, which included data on the mytilids from hydrothermal vents, cold seeps, whale falls, and sunken woods, revealed that all vent and seep mussels involved in our analysis are derived taxa within Bathymodiolinae (Fig. 3), but this result was poorly sustained on maximum-likelihood and maximum-parsimony trees by bootstraps values. Additionally, this analysis suggested that SAL-1 is a sister species for Idas washingtonia.

Fig. 3

Phylogenetic relationships among Bathymodiolinae (COI gene) using the maximum-likelihood method. Likelihood substitution model: HKY-85+[Γ]+I, with [α]=0.704 (−lnL=3973.9949) and base frequencies and ti:tv (13.34) estimated from the data. Bayesian posterior probabilities (top) and ML (bottom) analysis are presented (percentage of 1000 replicates). Dashes are values of <50%. Nodes for which posterior probabilities were below 0.95 and bootstrap value below 80% were collapsed.

When removing the third position of the codon in the COI dataset, all the resolution within the in-group was lost. Conversely, when the third position of the codon was removed in the ND4 dataset, the resolution of the tree was improved. Thus, as already suggested by [9], the COI dataset within Bathymodiolinae appeared only slightly saturated, contrary to the ND4 dataset. Thus in the combined four gene analysis, we removed the third codon position only for ND4. The combined four-gene analysis exhibited congruent topologies with the single-genes analyses. This combined Bayesian analysis first confirmed the basal position of individuals identified as SAL-3 relatively to all other species, NZ3 excluded (Fig. 4). Several lineages were identified in this most derived node but the relationships among them were not resolved by our analysis. Indeed, this analysis did not clarify relationships between T. fisheri, SAL-2, SAL-4 and three well-supported clades: (i) a ‘childressi’ clade that included B. childressi, B. mauritanicus, G. gladius and B. tangaroa; (ii) an ‘Idas’ clade that included SAL-1, I. washingtonia and I. macdonaldi; (iii) a ‘Bathymodiolus’ clade with well-supported internal nodes.

Fig. 4

Phylogenetic relationships among Bathymodiolinae based on four genes (COI, ND4, 28S, 18S) using the Bayesian analysis. For additional genes, Modeltest3.4 analyses allowed us to use HKY+[Γ] for ND4 (−lnL=2636.3689; K=5), TrN+[Γ]+I for 28S rRNA (−lnL=2370.9358; K=7), K80+[Γ]+I for 18S rRNA (−lnL=2820.5027; K=3). Bayesian posterior probabilities are presented. Nodes for which posterior probability was less than 0.95 were collapsed.

4 Discussion

Using a Barcoding-like approach, we were able to confirm our morphospecies delimitation. Indeed, four genetic clusters were detected, each one corresponding to a unique morphospecies. Moreover, there was no overlap between intra-phylotype and inter-phylotype genetic distances. The calculated intra-phylotypic distances within the four phylotypes were similar to intraspecific distances calculated within other bathymodilin species [5,6,31]. We then tried to attribute our morphospecies to described species. Rudo von Cosel identified the phylotype SAL-2 as Adipicola longissima (Thiele and Jaeckel, 1932). However, he could only give a genus name (Idas) to the three other morphospecies. We thus overall suggest that four distinct species from two genera were present in our sampling from the Solomon Islands. The three Idas species (SAL-1, -3 and -4) might correspond to new species.

Both analyses of nuclear 18S rRNA and mitochondrial COI genes revealed that the four sunken woods mussel species sampled from the Solomon Islands were included in the monophyletic group recognized by [4] as involving all species from hydrothermal vents, cold seeps and whale falls. Thus, our results confirmed, as suggested by [4], that the sunken woods mussels are closely related to mussels from reducing environments.

Moreover, contrary to the analysis of the 18S gene performed by [4], the analysis of the COI gene permitted to determine what outgroups to use in the analyses of the subfamily Bathymodiolinae. Indeed, this clade was robustly rooted on the species Modiolus modiolus. To determine how to root our ingroup, we needed to examine the relationships among Mytilids subfamilies. As a result, we confirmed the polyphyletic nature of Modiolinae and Mytilinae, already revealed by [12] with the analysis of 18S variability. Our results also permitted to clarify the points raised by [13] concerning the classification of Mytilidae. For example, from the data of [4,12,13], one can consider that the subfamily Arcuatulinae, defined by [15], was supported by the clustering of Hormomya domingensis and Geukensia demissa. Our analysis of COI data also supported this proposition. Moreover, [13] using several morphological analyses [14,15] and fossil records [16], as well as results of [4,12] suggested to cluster in the family Lithophagidae (Adams, 1857) five sub-families, among which Lithophaginae (Adams, 1857), Dacrydiinae (Ockelmann, 1983), Modiolinae s.s (Keen, 1958), and Bathymodiolinae. Our analysis revealed that the subfamily Bathymodiolinae is robustly rooted within a monophyletic group that included the species Modiolus modiolus that could be considered as a Modiolinae s.s. However, contrary to the proposition of [13], Lithophaginae and Dacrydiinae are not rooted within this clade.

Recent studies on Bathymodiolinae largely covered the diversity of vent and seep lineages, letting the sunken wood species apart. The study of [10], covering species from both Atlantic and Pacific ridge and from seeps and vent, revealed three distinct lineages. The study of [9] revealed that the taxa stemming from basal nodes occur in shallow sites, whereas the more derived taxa tend to occur at deeper sites. Thus, although these authors noted some exceptions to this trend, their dataset roughly support the general pattern recognized by Craddock et al. [3].

Our study recovered the hydrothermal lineages revealed by [9]. The slight differences observed with the topology of [9] concerned the position of B. brooksi within the ‘thermophilus’ clade and the unresolved position of B. tangaroa and G. gladius included within the ‘childressi’ clade in the analysis of Jones et al. [9]. These differences may either be due to the addition of more species in the dataset or to the slight differences between the models used for DNA evolution. Most of these lineages appear as strictly linked to hydrothermal environment. However, compared to previous studies, even if we increased the number of sunken wood species included in the phylogenetic analyses, we are far to cover the specific diversity of the sunken wood mytilids. Therefore, we cannot exclude that some sunken wood species belong to these apparently strictly hydrothermal lineages.

Our study, which added to the available datasets four sunken wood species, revealed that one of them – the SAL-3 morphospecies – has a basal position within the Bathymodiolinae monophyletic group. Thus, the results of [4], based only on the position of Benthomodiolus lignicola – which were moreover obtained with a poorly informative gene – are here supported by an enlarged dataset that includes more sunken wood species and more genes. In our analyses, vent and seep Bathymodiolinae appear as derived species, as well as the sunken wood morphospecies SAL-1, SAL-2 (A. longissima), and SAL-4.

Last, the four-gene analysis suggested that the lineage conducing to the undescribed NZ3 mussel sampled from a shallow hydrothermal seamount emerged after the lineage of Be. lignicola, but before that of the SAL-3 morphospecies, which emerged before the lineage that included all other Bathymodiolinae. Thus, the relative positions of NZ3 mussel and Be. lignicola suggest the existence of another older colonization event from wood to vents and seeps. This hypothesis may also explain why, based on morphological characters, it is difficult to place the NZ3 mussel within the genus Bathymodiolus and, more generally, within the genera sampled in modern hydrothermal vents and seeps. Modioliform mussels are known from hydrothermal vents since at least the Mesozoic [2]. However, it has recently been proposed that the first modioliform mussels presenting the morphological characteristics of modern Bathymodiolinae appeared during the Eocene both on cold seep carbonate and on sunken wood assemblages [33,34]. Thus, Be. lignicola and NZ3 mussels could belong to older lineages.

Overall, our results stress that, to understand the origin of hydrothermal vents and seep species, we need to have a better taxonomic coverage within the Bathymodiolinae monophyletic group. For that purpose, sunken woods and whalebones species from a larger geographical range must be included into the phylogenetic datasets.

Acknowledgements

We are grateful to the crew of the R/V Alis and the technical support of the IRD at Nouméa, to the staff of the ‘Service de systématique moléculaire’ at the ‘Muséum national d'histoire naturelle, Paris’, for technical facilities, and to the ‘Consortium national de recherche en génomique’, Genoscope. We thank P. Bouchet and B. Richer de Forges, the co-principal investigators of the Salomon2 cruise, and T. Haga for his great help in sampling during the cruise. We are grateful to Cyrille D'Haese for the development and access to the cluster at the MNHN. Special thanks to F. Pleijel for constructive comments and improvements of the English manuscript, and to F. Rousseau and an anonymous referee for helpful advices. This work belongs to a project included in the European research group DiWood, supported by the CNRS (France).


References

[1] W.A. Newman The abyssal hydrothermal vent invertebrate fauna. A glimpse of antiquity?, Bull. Biol. Soc. Wash., Volume 6 (1985), pp. 231-242

[2] C.T. Little; R.C. Vrijenhoek Are hydrothermal vent animals living fossils?, Trends Ecol. Evol., Volume 18 (2003), pp. 582-588

[3] C. Craddock; W.R. Hoeh; R.G. Gustafson; R.A. Lutz; J. Hashimoto; R.J. Vrijenhoek Evolutionary relationships among deep-sea mytilids (Bivalvia: Mytilidae) from hydrothermal vents and cold-water methane/sulfide seeps, Mar. Biol., Volume 121 (1995), pp. 477-485

[4] D.L. Distel; A.R. Baco; E. Chuang; W. Morrill; C. Cavanaugh; C.R. Smith Do mussels take wooden steps to deep-sea vents?, Nature, Volume 403 (2000), pp. 725-726

[5] Y. Won; C.R. Young; R.A. Lutz; R.C. Vrijenhoek Dispersal barriers and isolation among deep-sea mussel populations (Mytilidae: Bathymodiolus) from eastern Pacific hydrothermal vents, Mol. Ecol., Volume 12 (2003), pp. 169-184

[6] J.I. Miyazaki; M. Shintaku; A. Kyuno; Y. Fujiwara; J. Hashimoto; H. Iwasaki Phylogenetic relationships of deep-sea mussels of the genus Bathymodiolus (Bivalvia: Mytilidae), Mar. Biol., Volume 144 (2004), pp. 527-535

[7] S.B. Leschine Cellulose degradation in anaerobic environments, Annu. Rev. Microbiol., Volume 49 (1995), pp. 399-426

[8] V.C. Kenk; B.R. Wilson A new mussel (Bivalvia, Mytilidae) from hydrothermal vents in the Galapagos Rift Zone, Malacologia, Volume 26 (1985), pp. 253-271

[9] W.J. Jones; Y.-J. Won; P.A.Y. Maas; P.J. Smith; R.A. Lutz; R.C. Vrijenhoek Evolution of habitat use by deep-sea mussels, Mar. Biol., Volume 148 (2006), pp. 841-851

[10] H. Iwasaki; A. Kyuno; M. Shintaku; Y. Fujita; Y. Fujiwara; K. Fujikura; J. Hashimoto; L. de Oliveira Martins; A. Gebruk; J.-I. Miyazaki Evolutionary relationships of deep-sea mussels inferred by mitochondrial DNA sequences, Mar. Biol. (2006) | DOI

[11] P.D. Hebert; A. Cywinska; S.L. Ball; J.R. De Waard Biological identifications through DNA barcodes, Proc. R. Soc. Lond., Ser. B, Volume 270 (2003), pp. 313-321

[12] D.L. Distel Phylogenetic relationships among mytilidae (Bivalvia): 18S rRNA data suggest convergence in mytilid body plans, Mol. Phylogenet. Evol., Volume 15 (2000), pp. 25-33

[13] A.Y. Chichvarkhin Re: Phylogeny and taxonomy of marine mussels: comments on the paper by Distel (2000), Mol. Phylogenet. Evol., Volume 22 (2002), pp. 330-332

[14] T. Soot-Ryen Superfamily Mytilacea Rafinesque, 1815 (P.C. Moore, ed.), Treatise on Invertebrate Paleontology, Lawrence, Mollusca 6, Bivalvia, vol. 1, Geological Society of America and University of Kansas Press, 1969, pp. 271-280

[15] O.A. Scarlato; A.I. Starobogatov A systematic position and distribution of the marine mussels, Commercial Bivalve Mollusks – Mussels and their Role in the Ecosystems, Zool. Inst., Leningrad, USSR, 1979, pp. 106-111 (in Russian)

[16] N.D. Newell Superfamily Mytilacea Rafinesque, 1815 (P.C. Moore, ed.), Treatise on invertebrate paleontology, Lawrence, Mollusca 6, Bivalvia, vol. 1, Geological Society of America and University of Kansas Press, 1969, pp. 205-224

[17] O. Folmer; M. Black; W. Hoeh; R. Lutz; R. Vrijenhoek DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from metazoan invertebrates, Mol. Mar. Biol. Biotechnol., Volume 3 (1994), pp. 294-299

[18] J.P. Bielawski; J.R. Gold Unequal synonymous substitution rates within and between two protein-coding mitochondrial genes, Mol. Biol. Evol., Volume 13 (1996), pp. 889-892

[19] E. Arevalo; S.K. Davis; J.W.J. Sites Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloperus grammicus complex (Phrynosomatidae) in Central Mexico, Syst. Biol., Volume 43 (1994), pp. 387-418

[20] L.H. Qu, Structuration et évolution de l'ARN ribosomique 28S chez les Eucaryotes : étude systématique de la région 5′ terminale, thèse de l'université Paul-Sabatier, Toulouse, France, 1986

[21] F. Sanger; S. Nicklen; A.R. Coulson DNA sequencing with chain-terminating inhibitors, Proc. Natl Acad. Sci. USA, Volume 74 (1977), pp. 5463-5467

[22] M. Nei; S. Kumar Molecular Evolution and Phylogenetics, Oxford University Press, Oxford, UK, 2000

[23] S. Kumar; K. Tamura; M. Nei MEGA3: Integrated software for molecular evolutionary analysis and sequence alignment, Briefings Bioinf., Volume 5 (2004), pp. 150-163

[24] D.L. Swofford PAUP*4.0: Phylogenetic analysis using parsimony (and other methods), Sinauer Associates, Sunderland, Massachusetts, USA, 2002

[25] D. Posada; K.A. Crandall MODELTEST: testing the model of DNA substitution, Bioinformatics, Volume 14 (1998), pp. 817-818

[26] S. Guindon; F. Lethiec; P. Duroux; O. Gascuel PHYML Online – A web server for fast maximum-likelihood-based phylogenetic inference, Nucl. Acids Res., Volume 33 (2005), p. W557-W559

[27] J. Felsenstein Confidence limits on phylogenies: an approach using the bootstrap, Evolution, Volume 39 (1985), pp. 783-791

[28] F. Ronquist; J.P. Huelsenbeck MRBAYES 3: Bayesian phylogenetic inference under mixed models, Bioinformatics, Volume 19 (2003), pp. 1572-1574

[29] A. Gelman; D. Rubin Inference from iterative simulation using multiple sequences, Stat. Sci., Volume 7 (1992), pp. 457-511

[30] D.C. Campbell Molecular evidence on the evolution of the Bivalvia, Geol. Soc. Lond. Spec. Publ., Volume 177 (2000), pp. 31-46

[31] P.J. Smith; S.M. McVeagh; Y. Won; R.C. Vrijenhoek Genetic heterogeneity among New Zealand species of hydrothermal vent mussels (Mytilidae: Bathymodiolus), Mar. Biol., Volume 144 (2004), pp. 537-545

[32] J.S. Farris; M. Kallersjö; A.G. Kluge; C. Bult Constructing a significance test for incongruence, Syst. Biol., Volume 44 (1995), pp. 570-572

[33] S. Kiel New records and species of molluscs from tertiary cold-seep carbonates in Washington State, USA, J. Paleontol., Volume 80 (2006), pp. 121-137

[34] S. Kiel; J.L. Goedert A wood-fall association from Late Eocene deep-water sediments of Washington State, USA, Palaios, Volume 21 (2006), pp. 548-556


Comments - Policy