The Can Gio mangrove, in the Mekong Delta area, was designated as a coastal protection forest by a Vietnamese Ministerial Council Decision in 1991. In 1993, the State Forestry Enterprise was replaced by the Environmental Protection Forest (EPF) Management Board under the Department of Agriculture and Rural Development (DARD). In 2000, the EPF went under the jurisdiction of Can Gio District People's Committee, and Can Gio became the first Mangrove Biosphere Reserve in Viet Nam. The management was transferred from DARD to the Can Gio People's Committee and the Can Gio Forest Management Board (FMB). From various reports (grey literature in 2014) and our recent observations, the mangrove forest is in very good state in Can Gio, dense and diversified: 21,100 ha of Rhizophora apiculata were planted between 1978 and 2000 together with 715 ha of Eucalyptus spp. and 281 ha of Nypa fructicans (Miyagi et al., 2014). The Can Gio Reserve is divided into 24 forest compartments, each of which are divided into several sub-compartments (Fig. 1). The core zone (4720 ha) hosts the Can Gio FMB and is reserved for scientific activities. Only a few households live there. In the buffer zone (37,340 ha), forest exploitation is prohibited, while traditional exploitation of the rivers and tidal channels is unregulated. The transition zone (29,310 ha) is densely populated and hosts aquaculture farms (oysters, shrimps, etc.). Can Gio is unusual in that it relies on “protected forest concessionaires” (households under contract to protect the forest) in the core and buffer zones. In 1990, the government of Viet Nam invited new residents to come to settle down in the Reserve. Can Gio FMB signed contracts with 141 households, offering them land, a relocation grant and a small income for 30 years, in exchange for which they made a commitment to watch and protect the mangrove forest. Today, there are 160 protected forest concessionaires who are responsible for 80 ha on average (the smallest protected area is 25 ha and the largest is 300 ha).

The use of the mangrove was assessed through an interdisciplinary approach with a common sampling design for social and biological data. A field survey was carried out in June 2015 in 3 main zones of the Can Gio Mangrove Biosphere Reserve (Can Gio MBR) with local replicates (Fig. 1). The zones were (i) the core zone (C), a strictly protected ecosystem with restricted human activity, (ii) the buffer zone (B) nearby the core zone used for activities compatible with sound ecological practices, and (iii) the buffer-bis zone (BB), which is a part of the buffer zone where resource management, such as shellfish farming, is promoted. Bioabundance and biodiversity in the various zones were quantified using multiple indicators based on samples of two major compartments of the ecosystem affected by local population: microorganisms (mostly viruses and bacteria) and macro-organisms (polychaetes, molluscs and crustaceans), with the addition of genomic taxonomy for crabs and an investigation of the relationship between shellfish and humans. The rights of access and use of this diverse biological community by the local population were studied in the same zones at the same time to understand the system of values and cultural ecosystem services in this area (Fig. 1). To tie the social and biological data together, it was necessary to select sampling points along a transect in the Can Gio MBR coordinating spatial and temporal scales. This was the main problem to be solved when carrying out both social and biological surveys over two days, as the time for interviews for social data was longer than the duration of biological sampling, while biological sampling required replicates.

Interviews were conducted in the core and buffer zones of the Can Gio MBR (Fig. 1) with interviews of the main stakeholders within these areas, including fishermen, middlemen, seafood retailers, and oyster farmers. Two fishermen on fishing boats were interviewed on the Đông Tranh River in the core zone. One fisherman, one cockle farmer and one middleman were interviewed on the Đông Tranh River in the buffer zone. The buffer-bis zone had many oyster farms and two markets (Hàng Duong Market and Cân Thanh Market). A female seafood retailer in the Hàng Duong Market and an oyster farmer in the buffer-bis zone were interviewed. The questions addressed views and knowledge on the diversity of seafood products collected in the area, accessibility to resources, daily working life, exploiting mangrove products and forest conservation policies. Bivalves and gastropods, either sold in the market or found in the mangrove, were collected, and species were identified by local and scientific names and categorized according to provenance (sea mudflats or mangrove) and price.

For quantification of the aquatic and benthic viral and bacterial abundance, triplicate samples of 1.8 mL of surface water and 1.8 mL of sediment were collected in the core (C), the buffer (B), and the buffer-bis (BB) zones. The samples were transferred to cryotubes, fixed with formaldehyde (final concentration 3%) and stored in liquid nitrogen until analysis. The aquatic community was enumerated by taking a subsample of 300 μL from each water sample, filtering it onto 0.02-μm-pore-size membranes (Anodisc), and staining it with SYBR Gold. Benthic viruses and bacteria were enumerated as recommended by Danovaro et al. (2001). Aliquots of the fixed sediment samples (1 mL) were diluted with tetrasodium pyrophosphate (4 mL, final concentration, 10 mM), and incubated for 20 min at 4 °C. The samples were then sonicated three times (100 W for 1 min) and diluted 200-fold with filtered (0.02 μm) formaldehyde (final concentration, 2%). This procedure has been shown to extract the majority of viruses and bacteria from sediment (Glud and Middelboe, 2004). Samples were mounted on microscopic slides (Bettarel et al., 2006). On each slide, 500 to 600 bacteria and viruses were counted.

The abundance of macro-organisms in the mangrove infauna and the epifauna on the mangrove trees and the sediment surface was assessed at three sites on the intertidal mudflats in front of the mangrove stands of both the core (C) and buffer zones (B). Six replicate sediment cores, 10 cm in diameter and 10 cm in-depth were collected from each site. The cores were washed with filtered seawater through a 500-μm sieve and preserved in 4% formaldehyde seawater. Macrofauna species – polychaetes, molluscs and crustaceans – were identified and counted in the laboratory with the aid of a microscope and identification keys. A nested two-factor analysis of variance was carried out on the abundance data of the various macrofauna groups (factor 1 was the zone C/B, factor 2 was the site within the zone). A permutational analysis of variance (PERMANOVA) was used to detect potential differences in assemblage structure. Multidimensional scaling plots were used for graphical representation (Primer Statistical Package). All statistical analyses were performed using R statistical software (R Development Core Team).

For the analysis of crab diversity, the crabs present at each site (Fig. 1) were caught by a fisherman during a 30-min fishing period. Three replicate samples were taken at each site successively (three times 30 min of fishing). The samples were then processed on board or frozen for subsequent laboratory processing. Each individual was photographed, sexed, measured (shell width) and weighed, then, a sample of leg muscle was taken and stored in 96% ethanol in a microtube vial for genotyping. Some individuals were frozen as specimens. All individuals were counted per species (or morphotype). Of the 390 crabs collected, a subsample of 62 individuals was used for genotyping to determine the species or at least the number of putative species. These samples corresponded to the different morphotypes identified and photographed at each sampling station. Genomic DNA was extracted from the muscle tissue using PureLink^® Genomic DNA kit (Invitrogen). A portion of each cytochrome oxydase I gene (COI) was amplified by polymerase-chain reaction (PCR) using the primers LCO1490 (ggtcaacaaatcataaagatattgg) and HC02198 (taaacttcagggtgaccaaaaaatca) (Folmer et al., 1994). PCR was carried in a 40-μL reaction volume comprising 20 μL of FastStart PCR Master Mix (Roche), 0.6 μL of each primer (10 μM), 0.8 μL of BSA, 16 μL of ultra-pure H₂O, and 2 μL of DNA template. The PCR amplification process comprised a preliminary denaturation step at 92 °C for 5 min followed by 35 cycles of strand denaturation at 92 °C for 1 min, primer annealing at 40 °C for 45 s and primer extension at 72 °C for 1.5 min, followed by final extension at 72 °C for 5 min. Sequencing was performed by Macrogen Inc. (Seoul, South Korea; http://dna.macrogen.com). The sequences were edited using 4Peaks version 1.7 by A. Griekspoor and Tom Groothuis (mekentosj.com) and then aligned visually with Mega 5.0 (Tamura et al., 2011). The phylogenetic relationships between the crabs’ haplotypes were determined using a phylogenetic analysis based on a maximum-likelihood (ML) method implemented in Mega 5 (Tamura et al., 2011) with the heurist method set to nearest-neighbour interchange, a NJ/BioNJ initial tree, and a very strong branch swap filter. The support for the nodes was assessed by bootstrapping with 1000 pseudo-replicates.

The three protected zones of the Can Gio MBR are characterised by large differences in conservation policy that shape the exploitation and economy. Although mangrove tree harvesting is strictly forbidden in the Can Gio MBR, seafood fishing is less restricted. The main difference between the core zone and the buffer zone is the equipment used for fishing, which depends on the seafood targeted (fish, crustaceans, or molluscs). Permits from the Can Gio Mangrove Protection Forest Management Board are required for aquaculture. These permits are not restricted to the local inhabitants. Local inhabitants seem to have a good knowledge of the conservation rules for the different zones within the Can Gio MBR. In the buffer zones, they manage both the use of the mudflats for shellfish aquaculture, with resting periods of a few years for recovery, and the reforestation of the mangroves near the areas used for aquaculture.

The policies are focused on the management of the mangrove trees. The main objective of the Can Gio MBR management board is the protection of the mangrove forest by extending the area, diversifying the species planted, and prohibiting tree harvesting. The other resources, such as seafood, are not controlled and there seems to be no official limits to fishing, gathering shellfish, or aquaculture. Tourism and fishery are promoted ways of improving the local economy. Tenure is negotiated by the stakeholders.

Can Gio MBR is bounded by two rivers, the Soài Rap River (West side) and the Đông Tranh River (North-East side), emptying into the sea. It is divided into compartments, each with a different management and tenure system. The survey revealed a wide range of players involved in or affected by the Can Gio MBR (Fig. 2). There are three main groups: the representatives of the central and provincial governments, the protected forest concessionaires and the out-of-area or migrant users. There were many different categories of out-of-area users: men and women who gather wild crabs and molluscs from the mudflats on foot, seasonal fishermen who are natives of other provinces and use various fishing gear (diverse nets, baskets, pots and small artisanal dams), black cockle (Tegillarca granosa) farmers along the banks of the channels within the MBR who use netting to create non-permanent, more or less open, beds that are checked from boats, and those who farm oysters, shrimps and cockles in closed beds and who live in houses outside the MBR. In addition, some of the protected forest concessionaires also operate saltpans.

According to previous in-depth surveys (Burgos, unpublished) and the life stories collected during this survey, some stakeholders were identified as becoming richer, with a comfortable socio-economic status, such as new traders in Can Gio and protected forest concessionaires. On the other hand, some stakeholders, who used to be protected forest concessionaires, lost this status and became poorer and less privileged. A similar imbalance in access to finance and markets and differences in privilege between two groups of players, farmers and public forestry companies, was found in the Ca Mau mangroves close by (Ha et al., 2012). This reflects the inequality between the indigenous population and immigrants, as well as between farmers and more privileged government officers.

The benthic viruses and bacteria were much more abundant than the aquatic viruses and bacteria but, in all cases, there were no significant differences in abundance between the sampling sites (Fig. 3). Seven macrofauna groups were identified in the mudflat samples: polychaetes, small crabs, nematodes, mysidacea, copepods, stomatopods, and isopods (in order of decreasing abundance). Polychaetes were largely dominant. Epifauna on the mangrove trees and the sediment surface was very scarce at all sampling sites. No snails or bivalves were found in any of the samples. The analysis of variance did not detect any significant differences in the total abundance of macrofauna organisms between the buffer and the core zone or between sites (Fig. 4A; P > 0.05). Six out of the seven macrofauna groups – crabs, nematodes, mysidacea, copepods, stomatopods, and isopods – did not show any significant differences between zones or sites. The abundance of polychaetes was not significantly different between zones, although there were differences between certain sites in the buffer zone (Fig. 4A).

PERMANOVA did not show any pattern in macrofauna assemblage as a function of zones or sites (Fig. 4B). In the buffer zone, however, site 1 was significantly different from sites 2 and 3 (P(perm) = 0.002). The macrofauna assemblages were thus not affected by the different protection levels inside the Can Gio MBR and, in general, there were no clear differences between sites.

The biodiversity assessment was limited to the crab species as only a few mollusc and bivalve species were collected in the three zones. The three replicate samples in each of the three zones created a collection of 390 crabs. At first, looking at the morphology in the field, the crab diversity seemed very high, but genotyping showed that only four species were present (Fig. 5): two Uca species, U. annulipes, and U. paradussumieri, and two Metaplax species, M. elegans, and M. longipes. A precise description of the morphology of each species was created using the genotypes. Males are easily recognisable using morphology, but it is much more complicated for females. U. annulipes male has asymmetric claws (but the larger claw can be left or right), the larger claw is bicoloured (orange and white) and the shell is mottled. U. annulipes female has a mottled shell and hairy claws. U. paradussumieri male has asymmetric claws (the larger claw can be left or right), the larger claw has a uniform colour (from brown to dark yellow) and the shell is dark sometimes with dark yellow bands. U. paradussumieri female has a dark shell and hairy claws. M. elegans male has long thick orange claws and long legs. M. longipes male has small, thin orange claws and long legs. Metaplax females are very difficult (or impossible) to separate between species.

Uca were the most abundant in the total sample (70% vs. 30% Metaplax) and this ratio distinguished between the buffer-bis zone with intensive aquaculture (90% Uca vs. 10% Metaplax) and the core and buffer zones with a higher level of protection (around 50% of each genus). This result should be treated with caution, however, as natural environmental differences that might interact with the human activities were not measured here.

The study successfully undertook a preliminary interdisciplinary survey of the Can Gio MBR. One of the main conclusions, shared by the scientists and the stakeholders, was the ecological and social relevance of the reserve management strategy. From a social point of view, local users not only are aware that they are living within a reserve, knowing its limits and rules, but they also participate in its sustainable management and take benefits from its goods and services.

Although biological sampling was limited both spatially and in terms of taxa, the viral, bacterial and infauna abundance and the crab diversity were similar in the core and buffer zones, even if the buffer-bis zone with its more intensive aquaculture showed differences in terms of crab diversity. Does this mean that the management and exploitation of the mangrove have a relatively low effect on abundance and diversity? The question cannot be answered yet. The results should indeed be interpreted with caution, as environmental differences not measured here (variations in mangrove vegetation structure, sediments and hydrodynamic conditions, physical and chemical gradients in the waters) can also affect the assemblages.

The most notable finding is the low level of crab genotype diversity, even though there were strong differences between morphotypes and sizes (results not presented). Our knowledge of crab diversity in the Can Gio MBR relies mostly on grey literature, as there is very little published data in international journals. A study of the crab diversity and its resilience to a typhoon indicated that only 12 species were present in Can Gio (Diele et al., 2013). In the area sampled in the present study, the even lower level of diversity could be a result of the limited area sampled (part of the core and buffer). An additional aspect of the social survey could be to determine whether people give different names for crabs of the same species (genetically identified) presenting different morphologies. This could give an idea for the general perception of the biodiversity by the stakeholders.

An “interdisciplinary” approach is a close coordination between disciplines, from the joint development of a conceptual and methodological framework up to the integrated analysis of the results. This approach is to be distinguished from the “multidisciplinary” one, which can be a simple juxtaposition of various disciplines and from the “transdisciplinary” one, which combines disciplines so as to achieve a single objective using various methods. Many “transdisciplinary” researchers (Bouamrane et al., 2013; Weber, 1996) have argued that interdisciplinarity cannot be decreed, but is a question of practice, particularly in the field. Social studies can be undertaken from the local level (e.g., exploitation of mangrove crabs) to the global (e.g., impact of international conventions and mechanisms such as REDD+). Biological studies can be undertaken from the individual scale to the community or the meta-community scale over a very wide range of time scales. Both methodological and ontological issues affect the spatial scales of data collection (see also Johnston et al., 2000; see Sayre, 2005). The geographical scale is important for both ecology and human geography, and processes and interactions rather than scale per se should be the object of research, with particular attention to non-linearities and thresholds of change (Sayre, 2005).

Further empirical studies are required for in-depth characterization of the stakeholders and for understanding of the socio-economic and political contexts. We must refine the stakeholder categories (indigenous vs. migrant, beneficiaries and protected forest concessionaires vs. excluded or marginalized households) and determine their knowledge and practices, their traditional rights of access and exploitation, the individual and institutional development paths and public policies. It is necessary to describe and analyse the systems of mangrove tenure and enclosure. During this first survey, which should be considered as a test, the accent was put on the food uses of molluscs and bivalves, but it is necessary to include the use of other seafoods (e.g., crabs) and forest products. It is also necessary to investigate the seasonality of resource use and exploitation and the distribution of resources within the MBR. Furthermore, further investigation is required concerning synergies and competition (for instance between fishing and intensive aquaculture) and conflicts between incompatible tenures, as well as the sources of conflicts and the processes of conflict resolution. It is also necessary to analyse the environmental policies and private activities (both endogenous and exogenous) in favour of mangrove services and determine their effects on the local dynamics.

Research in social sciences requires a long immersion in the field. In many cases, in-depth investigations are preceded by a first introductory visit to take the measure of the study site and introduce the research team to the stakeholders. Then, the interviews themselves may last several hours and may be spread over several days or even months. For example, the mangrove uses vary with the tide and the seasons. In addition to the seasonal calendar of activities, life histories or biographies, retrospective surveys, personal plans and links between families are useful for understanding the stakeholders’ strategies and timing for adapting to change.

A simple visit to one of the Can Gio markets and the Binh Điên grocery market in Ho Chi Minh City showed the wide diversity and the large quantity of products from the rivers and the sea, the mass of stakeholders in these networks, and their economic and social weight. It also raised questions about the durability of the sector and the need for organising the value chains for the products from the sea and from the mangrove. This requires studies of the production sites, local markets, regional markets and other distribution centres, outlets (restaurants, Ho Chi Minh City markets), and the food and culinary heritage. Comparative studies of the quality of products from or associated with the mangrove (wild vs. farmed shellfish, from the mangrove itself, the channels or the foreshore) are required to determine the relevance of the protected food designations. The certification of the products could be considered as a mean for increasing biodiversity (increasing value to decrease pressure on the resources). Other forms of exploitation, such as tourism and ecotourism, also need to be studied. Finally, the flows and exchanges between the mangrove and other socio-ecosystems must be determined and analysed.