Plan
Comptes Rendus

Taxonomy / Taxinomie
Phylogenetic relationships and biodiversity in Hylids (Anura: Hylidae) from French Guiana
[Relations phylogénétiques et biodiversité chez les Hylidés (Anura : Hylidae) de Guyane française]
Comptes Rendus. Biologies, Volume 328 (2005) no. 10-11, pp. 1009-1024.

Résumés

We evaluated two biodiversity criteria, higher taxonomic diversity and phylogenetic diversity in French Guiana. For this, we used a recent assessment of the knowledge accumulated since 30 years of study on the amphibian species currently known in French Guiana. We focused on two well-represented genera, Hyla and Scinax, belonging to the subfamily Hylinae. We used partial sequences of two mitochondrial genes (16S rDNA and 12S rDNA, 813 bp) and two nuclear genes (tyrosinase and 18S rRNA, 1590 bp) covering a total of 2403 bp. According to the high bootstrap support in phylogenetic analysis of the complete dataset, the genus Scinax is a homophyletic clade formed by two species groups (rubra and rostrata) in French Guiana. The genus Hyla was confirmed to be a paraphyletic group formed by two species groups as well (30 chromosomes and the ‘gladiator frogs’). We confirmed that these genera should be taxonomically reconsidered. Moreover, at the genus, subfamily and family levels, the use of only morphological characters or only molecular DNA markers would hamper estimations of biodiversity. Thus, we strongly advise the combined use of both morphology and molecular data (nuclear and mitochondrial markers).

Nous avons évalué deux critères de biodiversité, la diversité taxonomique et la diversité phylogénétique en Guyane française. À cet effet, nous nous sommes appuyés sur une étude récente faisant le bilan de toutes les espèces d'Amphibiens de cette région. Nous avons choisi deux genres bien représentés, Hyla et Scinax, appartenant à la sous-famille des Hylinae. Nous avons analysé les séquences partielles de deux gènes mitochondriaux (16S ADNr et 12S ADNr, pour un total 813 pb) et de deux gènes nucléaires (tyrosinase et 18S ADNr,) l'ensemble représentant 2403 pb. Les proportions de bootstrap élevées pour le jeu de données complet montrent que le genre Scinax est un clade homophylétique en Guyane. Le genre Hyla s'est avéré être un groupe paraphylétique, constitué de deux groupes ( « 30 chromosomes » et gladiator frog). Nous avons confirmé que ces genres doivent être reconsidérés sur un plan taxonomique. De plus, pour les unités taxonomiques (genre, sous-famille et famille), la seule utilisation des caractères morphologiques ou des marqueurs moléculaires ADN biaiserait l'estimation de la biodiversité. Ainsi, nous conseillons fortement l'utilisation à la fois des données morphologiques et moléculaires (marqueurs nucléaires et mitochondriaux).

Métadonnées
Reçu le :
Accepté le :
Publié le :
DOI : 10.1016/j.crvi.2005.07.005
Keywords: Amphibia, Scinax, Hyla, Centrolenidae, Phylogenetic diversity, French Guiana
Mots-clés : Amphibia, Scinax, Hyla, Centrolenidae, Diversité phylogénétique, Guyane française

Marie-Dominique Salducci 1 ; Christian Marty 2 ; Antoine Fouquet 1, 3 ; André Gilles 1

1 Laboratoire d'hydrobiologie, EA EGEE 3178, université de Provence, 3, place Victor-Hugo, 13331 Marseille, France
2 Impasse Jean-Galot, 97354 Montjoly, French Guiana
3 Molecular Ecology Laboratory, School of Biological Sciences, University of Canterbury, Private Bag 4800, Christchurch, New Zealand
@article{CRBIOL_2005__328_10-11_1009_0,
     author = {Marie-Dominique Salducci and Christian Marty and Antoine Fouquet and Andr\'e Gilles},
     title = {Phylogenetic relationships and biodiversity in {Hylids} {(Anura:} {Hylidae)} from {French} {Guiana}},
     journal = {Comptes Rendus. Biologies},
     pages = {1009--1024},
     publisher = {Elsevier},
     volume = {328},
     number = {10-11},
     year = {2005},
     doi = {10.1016/j.crvi.2005.07.005},
     language = {en},
}
TY  - JOUR
AU  - Marie-Dominique Salducci
AU  - Christian Marty
AU  - Antoine Fouquet
AU  - André Gilles
TI  - Phylogenetic relationships and biodiversity in Hylids (Anura: Hylidae) from French Guiana
JO  - Comptes Rendus. Biologies
PY  - 2005
SP  - 1009
EP  - 1024
VL  - 328
IS  - 10-11
PB  - Elsevier
DO  - 10.1016/j.crvi.2005.07.005
LA  - en
ID  - CRBIOL_2005__328_10-11_1009_0
ER  - 
%0 Journal Article
%A Marie-Dominique Salducci
%A Christian Marty
%A Antoine Fouquet
%A André Gilles
%T Phylogenetic relationships and biodiversity in Hylids (Anura: Hylidae) from French Guiana
%J Comptes Rendus. Biologies
%D 2005
%P 1009-1024
%V 328
%N 10-11
%I Elsevier
%R 10.1016/j.crvi.2005.07.005
%G en
%F CRBIOL_2005__328_10-11_1009_0
Marie-Dominique Salducci; Christian Marty; Antoine Fouquet; André Gilles. Phylogenetic relationships and biodiversity in Hylids (Anura: Hylidae) from French Guiana. Comptes Rendus. Biologies, Volume 328 (2005) no. 10-11, pp. 1009-1024. doi : 10.1016/j.crvi.2005.07.005. https://comptes-rendus.academie-sciences.fr/biologies/articles/10.1016/j.crvi.2005.07.005/

Version originale du texte intégral

Le texte intégral ci-dessous peut contenir quelques erreurs de conversion par rapport à la version officielle de l'article publié.

1 Introduction

Some of the greatest challenges for biologists are to understand and to evaluate biodiversity [1]. One of the measures commonly used to assess biodiversity is species richness, as defined by the number of species at a site or habitat. However, the evaluation of species richness is strongly dependent on the definition of a species, an intensively debated question [2]. Therefore, higher taxon richness, mostly on morphological criteria, is often used as a surrogate to evaluate biodiversity rather than species richness [3,4]. This approach is valid only if there is no systematics bias, i.e., when only monophyletic groups are used and when the taxonomic boundaries are similar among groups.

Another way of measuring biodiversity involves the screening of genetic variability among populations. Genetic variability may be at least partly reflected by the phylogenetic diversity (PD), which is estimated as the sum of the branch lengths in a phylogenetic tree [5]. The genetic and morphological approaches generate different assessments of biodiversity values, perhaps reflecting differences in the temporal and spatial scales of the determining processes [6]. It is therefore necessary to clarify their practical utility for the assessment of biodiversity in taxa in which an exhaustive inventory cannot be compiled due to the high number of species and/or the environmental conditions.

This is often the case in tropical environments, where the greatest species diversity is recorded [7–10], as for amphibians. The rate of description of new species is also higher in these zones than anywhere else [11].

The Guianan region is one of the last wild areas in South America and among the three richest tropical regions on Earth (Guiana Shield Conservation Priority Setting Workshop, 5–9 April 2002, Paramaribo, Surinam). However, it is extremely difficult to assess the diversity of many taxa in this region for practical reasons. This is the case for amphibians, for which biologists are extremely concerned since few years. Indeed, this group is subject to a fast worldwide decline particularly worrying in South America [12–16]. Even though collecting efforts have intensified in many previously unknown areas, especially in this part of the world [17], large regions remain unknown and many reduced areas of potentially high diversity have not been examined [18]. There is therefore an urgent need to characterise the diversity of amphibians by using rigorous approaches. It is unclear whether this should involve higher taxonomic biodiversity analysis, phylogenetic diversity analysis or both.

Here, we used a recent taxonomical, geographical and ecological assessment based on 30 years of work on the species present in French Guiana. It concerns 110 amphibian species over 90 000 km2 [19]. We considered taxonomy as a surrogate of morphological diversity. Thus, we chose a group for which we know the number of morphologically distinct species, their distribution area and basic aspects of their ecology (the habitat). We concentrated on amphibians belonging to the second largest frog family in South America: the Hylidae (neotropical tree frogs), with 25 genera in this part of the world [17]. The family Hylidae is divided into four subfamilies [20], only two of which are present in French Guiana: the Phyllomedusinae, with four species, and the Hylinae, with 38 species [19,21,22].

Members of the subfamily Phyllomedusinae are widely distributed in tropical parts of Middle and South America [23]. In this group, the constricted pupil is vertically elliptical. These tree frogs, with a green dorsal coloration, are adapted to an arboreal lifestyle. Only one genus, Phyllomedusa, among the three genera constituting this group, is present in French Guiana [19].

Members of the subfamily Hylinae are found throughout the temperate and tropical parts of North and South America, in temperate Eurasia, Japan, extreme northern Africa, and the West Indies [24]. Five genera are found in French Guiana: Hyla, Scinax, Osteocephalus, Phrynohyas and Sphaenorhynchus. The two largest Hyline genera are Hyla and Scinax, containing respectively 45 and 7 species groups (or currently five species groups [25]).

The genus Hyla does not share any unique features and two major groups within Hyla are present in French Guiana, the Gladiator frogs sensu lato and the 2 n=30-chromosome lineage [24,26]. The Gladiator frogs are represented by seven species groups in French Guiana and the 30-chromosome Hyla by six species groups [19]. This is the only genus within hylines found in North, Central and South America, Eurasia and the extreme north of Africa [24,27]. We have previously shown that some representatives of the genus Hyla form a monophyletic group according to partial 16S rRNA gene sequences, but the bootstrap proportion was low [28]. In contrast, morphological analysis revealed that this genus was paraphyletic [27]. These results seem to be contradictory and require clarification.

The genus Scinax is divided into seven [19] or five groups [25,29]. Two of these are represented in French Guiana. The first is the rostrata group, which includes Scinax jolyi, Scinax proboscideus and Scinax nebulosa. The second is the rubra group, which includes Scinax rubra, S x-signatus, Scinax boesemani and Scinax cruentomma [19,25]. Faivovich [29] found the rostrata group to be nested within the rubra group, making it non-monophyletic. Scinax species were initially informally grouped in a Hyla rubra group [29], mainly on the basis of sperm cell morphology, then included in a genus named Ololygon. It was only in 1992 that the name Scinax took priority over Ololygon [30]. In a previous study based on 16S rRNA gene sequences and a few species, we showed that the Scinax genus was homophyletic and supported by a high bootstrap proportion [28]. Moreover, based on morphology, this homophyly is supported by ten synapomorphies [29].

In the light of this systematic framework, we use a subset of species constituted by 33 specimens belonging to the family Hylidae (genera Scinax, Osteocephalus, Hyla, and Phrynohyas), three specimens from the family Centrolenidae (Hyalinobatrachium and Cochranella genera) were used to verify the impact of outgroup on Hylinae phylogenetics relationships [28,31,32], and two Eleutherodactylus (Leptodactylidae) specimens were used as outgroups. Phylogenetic diversity was estimated by sequencing two mitochondrial genes (16S and 12S rDNA) and two nuclear genes (18S rDNA and tyrosinase). These sequences have been successfully used to assess the relationships among some orders, families and species of amphibians [31–40].

In this paper, we tested congruence between molecular and morphological/taxonomic data at the species, genus and family levels in one subset representative of amphibian diversity in the Guianan region.

If there is congruence between molecular markers and morphology, the morphological criteria will be sufficient for the study of neotropical frog biodiversity and the higher taxonomic diversity criteria will be a rigorous alternative for the conservation of divergent lineages.

If there is no congruence between molecular markers and morphology in this representative subset, morphology must be systematically coupled to molecular markers when studying the biodiversity of neotropical frogs and the higher taxonomic diversity must be coupled to phylogenetic diversity for the conservation of divergent and reticulate lineages.

2 Materials and methods

2.1 Biological samples

Twenty-nine new species were added to those studied by Salducci et al. [28]. Thus, a total of 143 new sequences were obtained from 33 Hylidae constituted by 11 individuals belonging to the genus Scinax (four species assigned to the rubra group and four species to the rostrata group), 14 to the genus Hyla (Gladiator frogs: four species of the geographica group, two of the albopunctata group and one for the boans group and one for the granosa group; Hyla 30 chromosomes: two species of the nana group, one of the leucophyllata group, one of the luteocellata group 1 of the minuta group, one of the parviceps group), three to the genus Osteocephalus, two to the genus Phrynohyas, and three to the genus Phyllomedusa. Three specimens from the Centrolenidae (Hyalinobatrachium and Cochranella genera) and two Leptodactylidae (Eleutherodactylus) were used as outgroups. Thirty-six specimens were collected in French Guiana over a four-year period. Samples of Scinax rostrata and Scinax elaeochroa were collected respectively in Venezuela and in Costa Rica (National Museum of Natural History of The Netherlands). The geographical ranges of the specimens examined are given in Table 1, and a map of collecting localities is given in Fig. 1. Tissue samples were derived from muscle by performing a biopsy. From preserved specimens in collections, we used liver tissues preserved in ethanol.

Table 1

List of batrachians used for this study, with the locality number (see Fig. 1)

Family Subfamily Species Genbank accession number 16S Genbank accession number 12S Genbank accession number 18S Genbank accession number tyrosinase Origin locality number
Hylidae Hylinae Scinax rubra 1 AF467264 Guiana Antecum Pata 6
Scinax rubra 2 Guiana Grand Santi 7
Scinax cruentomma 1 AF467263 Guiana Mountain of Kaw 3
Scinax cruentomma 2 Guiana Mountain of Kaw 3
Scinax jolyi 1 AF467261 Guiana Swamp of Kaw 3
Scinax jolyi 2 AF467261 Guiana Creek of Gabrielle 2
Scinax nebulosa AF467262 Guiana Regina Road St Georges 4
Scinax proboscideus Guiana Mountain of Kaw 3
Scinax boesemani Guiana Grand Santi 7
Scinax rostrata Venezuela
Scinax elaeochroa Costa Rica
Hyla leucophyllata Guiana Mountain of Kaw 3
Hyla sp1 Guiana Mountain of Kaw 3
Hyla minuscula Guiana Mana 9
Hyla ornatissima Guiana ChutesVoltaires 8
Hyla raniceps AF467269 Guiana Yi-Yi's Creek 1
Hyla dentei AF467270 Guiana Mountain of Kaw 3
Hyla brevifrons Guiana Mountain of Kaw 3
Hyla multifasciata Guiana Mountain of Kaw 3
Hyla nana Guiana Mountain of Kaw 3
Hyla minuta Guiana Mountain of Kaw 3
Hyla boans Guiana Mont Bakra 11
Hyla geographica Guiana Grand Santi 7
Hyla fasciata Guatemala 14
Hyla calcarata Guiana Creek of Margot 13
Hylidae Hylinae Osteocephalus oophagus AF467267 Guiana Mountain of Kaw 3
Osteocephalus taurinus Guiana Saül 12
Osteocephalus leprieurii Guiana Creek of Margot 13
Phrynohyas coriacea Guiana Mountain of Kaw 3
Phrynohyas venelosa Guiana Guatemala 14
Phyllomedusinae Phyllomedusa tomopterna Guiana Mountain of Kaw 3
Phyllomedusa hypochondrialis Guiana Grand Santi 7
Phyllomedusa bicolor Guiana Saül 12
Centrolenidae Hyalinobatrachium taylori AF467268 Guiana Creek of Gabrielle 2
Hyalinobatrachium taylori 2 Guiana Tibourou 10
Cochranella sp Guiana Mont Bakra 11
Leptodactylidae Eleutherodactylinae Eleutherodactylus zeuctotylus1 Guiana Mountain of Kaw 3
Eleutherodactylus zeuctotylus 2 Guiana Tibourou 10
Fig. 1

Map of French Guiana showing the localities of the samples collected.

© 2000 ‘Service du patrimoine naturel’, MNHN, Paris.

2.2 Molecular data

Total DNA was extracted from muscle tissue samples by digestion with proteinase K for 12 h at 37 °C followed by standard phenol/chloroform extraction [41]. Two partial mitochondrial (mt) and two nuclear (nu) DNA fragments were amplified by standard PCR techniques. The mt DNA fragments were: 430 bp of the 16S rDNA gene and 397 bp of the 12S rDNA gene. These fragments were amplified using the primers listed in Table 2. The nuclear DNA fragments were: 403 bp of exon 1 of the tyrosinase gene and 1187 bp of the 18S rRNA gene. The primers used for amplification were as described by Bossuyt and Milinkovitch [42] for tyrosinase and by Miquelis et al. [43] for 18S rDNA.

Table 2

Primers used for amplifying and sequencing segments of mitochondrial genes F at the end of the primer name = forward, R at the end of the primer name = reverse

Name Gene Sequence 5-3 Reference
N-934F 16S CGCCTGTTTACCAAAAACATCG [72]
3259R 16S CCGCTTTGAGCTCAGATCA [73]
N16F 16S TATCCCTAGGGTAACTTG This study
N16R 16S TTACCAAAAACATCGCCT This study
N316F 16S GGAGGTTATTTTTTGTTC This study
N316R 16S CGAGAAGACCCTATGGAG This study
N12F 12S GGTATCTAATCCCAGTTTGT This study
N12R 12S AGGTTTGGTCCTAGCCTT This study
12LPF tRNA phe-L 12S GCRCTGAARATGCTRAGATGARCCC [74]
12HSR 12SF-H 12S CTTGGCTCGTAGTTCCCTGGCG [74]
Tyr1A Tyrosinase AGGTCCTCTTRAGCAAGGAATG [42]
Tyr1E Tyrosinase GAGAAGAAAGAWGCTGGGCTGAG [42]
18SF 18S1 CCACATCCAAGGAAGGCAGCAGGC [43]
18SR 18S1 CCCGTGTTGAGTCAAATTAA [43]
18S2F 18S2 CGTAGTTCCGACCATAAA This study
rev-Hillis18g-S 18S2 GGAAACCTTGTTACGACTT [74]

PCR was performed in a 50-μl total volume as in Gilles et al. [44]. Cycle parameters were as follows:

  • – for 16S rDNA, 2 min at 92 °C; then five cycles of 15 s at 92 °C, 45 s at 46 °C, 1 min 30 s at 72 °C; then 30 cycles of 15 s at 92 °C, 45 s at 48 °C, 1 min at 72 °C; and finally 7 min at 72 °C;
  • – for 12 S rDNA and 18S rDNA, 2 min at 92 °C; then 5 cycles of 15 s at 92 °C, 45 s at 48 °C, 1 min 30 s at 72 °C; then 30 cycles of 15 s at 92 °C, 45 s at 52 °C, 1 min at 72 °C; and finally 7 min at 72 °C;
  • – for tyrosinase, 2 min at 92 °C; then five cycles of 15 s at 92 °C, 45 s at 50 °C, 1 min 30 s at 72 °C; then 30 cycles of 15 s at 92 °C, 45 s at 54 °C, 1 min at 72 °C; and finally 7 min at 72 °C.

The purified PCR products were sequenced using an automated sequencer (Genome Express S.A.) and the same PCR primers as used in amplifications. Fifteen new sequences were obtained for the 410-bp fragment of 16S rDNA and 24 new sequences were obtained for the 403-bp fragment of 12S rDNA, for the 1197-bp fragment of 18S rDNA and for the 393-bp fragment of tyrosinase. See Table 1 for accession numbers.

2.3 Data analysis

The 16S rDNA and 12S rDNA gene sequences were aligned using Clustal X [45] and compared with the alignment based on secondary structure [46]. The 16S secondary structure was visualised as described in [28]. We carried out a similar procedure with the Rana pipiens sequence as a model for the 12S secondary structure. The amplified 12S fragments corresponded to the helices 1 to 26. For this study, we used the software SOAP [47] to identify unstable blocks in alignments for the 16S and the 12S datasets. Saturation was visualised using the software package MUST [48].

Phylogenetic analyses were performed using three different approaches:

  • (1) the Neighbour-Joining (NJ) method [49], using a matrix based on the Tamura–Nei distance with gamma parameter [50];
  • (2) a cladistic approach using the Maximum-Parsimony (MP) criterion and the heuristic search with 10 random additions of taxa and TBR branch-swapping as implemented in PAUP 4b10 [51];
  • (3) the maximum-likelihood (ML) method using the evolutionary model retained by MODELTEST [52]:
    • – Lset mitochondrial (GTR + I + G selected by AIC) Base = (0.2671 0.1631 0.2136) Nst = 6 Rmat = (0.1829 5.4352 1.1539 0.2491 1.7544) Rates = gamma Shape = 0.6890 Pinvar = 0.2813;
    • – Lset nuclear Base = equal Nst = 2 TRatio = 1.9683 Rates = gamma Shape = 0.6991 Pinvar = 0;
    • – Lset combined (GTR + I + G selected by AIC) Base = (0.2427 0.2246 0.2452) Nst = 6 Rmat = (0.2603 4.6592 1.3927 0.3127 1.7642) Rates = gamma Shape = 0.5049 Pinvar = 0.5292.
The procedure described by Rogers and Swofford [53] was used to reduce the preliminary computing time. The robustness of nodes was estimated by bootstrap analysis with 1000 replicates for the NJ and MP methods [51], and 500 replicates for the ML method. Differences in topology between trees based on conserved versus variable regions of the 16S rDNA sequences were tested as described in Salducci et al. [28] and were shown to be non-significant. We used the Incongruence Length Difference (ILD) test [54] as implemented in PAUP 4b10 with α=0.05 to compare the trees obtained in stable and unstable zones. This test is useful to detect incongruence between different partitions [43,55–57], but has only limited power to detect incongruence caused by differences in the evolutionary process or in the tree topology [58] or when two datasets differ markedly in size [59]. The Wilcoxon sign-rank test [60] and the Shimodaira–Hasegawa test [61] were also calculated to assess the significance of topology differences respectively in parsimony and maximum-likelihood frameworks. Finally, departure from the molecular clock was tested using relative rate tests as implemented in PHYLTEST [62]. We studied the mismatch distribution between the sequences by using the Kimura two-parameter distance as genetic distance. The average distance between two groups is the arithmetic mean of all pairwise distances between taxa in the inter-group comparisons and the within-group means are arithmetic means of all individual pairwise distances between taxa within groups belonging to: the genus Hyla, the genus Scinax, the subfamily Hylinae, the family Hylidae, and between the families Hylidae and Centrolenidae, using the morphological hierarchical level and under the hypothesis that there is no departure from the molecular clock. Under this assumption, the mismatch distribution between two comparable hierarchical levels will not be significantly different and the mismatch distribution between two different levels (i.e., genus versus subfamily) will be significantly different. Due to the difference in sample size, the Kolmogorov–Smirnov test was used to test the homogeneity between the different distributions with α=0.05.

3 Results

3.1 Combined analysis of mitochondrial datasets

3.1.1 Phylogenetic analysis

The incongruence test detected no significant heterogeneity between the 12S and 16S datasets (p=0.018). Indeed, according to the Shimodaira–Hasegawa and Wilcoxon sign-rank tests, the 16S constraint trees were significantly different to the 12S and total data trees (considering the 12S rDNA dataset and the total dataset). However, the 12S and total data trees did not differ significantly from the 16S rDNA tree according to the Shimodaira–Hasegawa test (considering the 16S rDNA dataset). This pattern seems to be due to the lack of phylogenetic information in the 16S dataset since few nodes were supported.

Saturation was observed from the transition and transversion substitution patterns (Fig. 2A, C, and E). The homophyly of the Hylinae genera was tested using an 813-bp region of the total dataset. Of the 813 positions, 394 were informative (gaps were treated as missing for the unweighted parsimony analysis). We found one single parsimonious tree (2035 steps). The g1 value was −0.76, the CI was equal to 0.387, the RI was equal to 0.620.

Fig. 2

(A) Scatter plots obtained from 813 positions of the 16S rDNA and 12S rDNA of 38 species. X axis: pairwise number of substitutions using the p distance; Y axis: pairwise number of substitutions using the Tamura–Nei model with alpha = 0.30 (open circle) and Jukes and Cantor (black circle). (B) Scatter plots obtained from 1590 positions of the tyrosinase and 18S rDNA of 38 species. X axis: pairwise number of substitutions using the p distance; Y axis: pairwise number of substitutions using the Tamura–Nei model with alpha = 0.21 (open circle) and Jukes and Cantor (black circle). (C) Distribution of the transition–transversion ratio using the 16S rDNA and 12S rDNA of 38 species (μ=1.26; σ=0.49). (D) Distribution of the transition–transversion ratio using the tyrosinase and 18S rDNA of 38 species (μ=1.81; σ=0.57). (E) Scatter plots obtained from 813 positions of the 16S rDNA and 12S rDNA of 38 species. X axis: pairwise number of substitutions using transversions; Y axis: pairwise number of substitutions using the transition. (F) Scatter plots obtained from 1590 positions of the tyrosinase and 18S rDNA of 38 species. X axis: pairwise number of substitutions using transversions; Y axis: pairwise number of substitutions using the transition. (G) Scatter plots obtained for 38 species, X axis: pairwise number of substitutions using the Tamura–Nei model with alpha = 0.21 from 1590 positions of the tyrosinase and 18S rDNA; Y axis: pairwise number of substitutions using the Tamura–Nei model with alpha = 0.30 obtained from 813 positions of the 16S rDNA and 12S rDNA. (H) Distribution of the transition–transversion ratio using the tyrosinase, 18S rDNA, 16S rDNA and 12S rDNA of 38 species (μ=1.62; σ=0.40). (I) Scatter plots obtained from 2403 positions of the tyrosinase, 18S rDNA, 16S rDNA and 12S rDNA of 38 species. X axis: pairwise number of substitutions using transversions; Y axis: pairwise number of substitutions using the transition. Masquer

(A) Scatter plots obtained from 813 positions of the 16S rDNA and 12S rDNA of 38 species. X axis: pairwise number of substitutions using the p distance; Y axis: pairwise number of substitutions using the Tamura–Nei model ... Lire la suite

The combination of the two datasets showed phylogenetic relationships within the French Guianan Hylidae at a better resolution than fragments analysed separately (Fig. 3). The genus Scinax constituted a homophyletic group with a high bootstrap support (BP = 100/100/97, ML/MP/NJ). We detected two groups: the first one, the rostrata species group was constituted by Scinax jolyi, Scinax proboscideus, Scinax rostrata and Scinax nebulosa (BP = 92/100/100) and the second one, the rubra species group by Scinax rubra, Scinax cruentomma, Scinax boesemani and Scinax elaeochroa (BP = 98/100/100).

Fig. 3

Bootstrap analyses carried out with 1000 iterations using the 813 pb of the 16S rDNA and 12S rDNA among 38 ‘species’ of Hyla, Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, Cochranella and Hyalinobatrachium genera: using Maximum-Likelihood bootstrap value on the left, Maximum-Parsimony bootstrap value on the middle, Neighbour-Joining on a matrix of the Tamura–Nei (alpha = 0.30) model right bootstrap value. The Maximum-Likelihood tree is shown (−ln=9450.77869). The tree was rooted on Eleutherodactylus as outgroup. Masquer

Bootstrap analyses carried out with 1000 iterations using the 813 pb of the 16S rDNA and 12S rDNA among 38 ‘species’ of Hyla, Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, Cochranella and Hyalinobatrachium genera: using Maximum-Likelihood ... Lire la suite

The homophyly of genus Hyla was not supported (Fig. 3). The homophyly of the two major groups of Hyla was confirmed by the ‘mitochondrial total evidence’ approach (BP = 89/74/85 for the first 30 chromosomes group H. minuscula, Hyla nana, H. sp1, H. leucophyllata, H. brevifrons, H. minuta, and bp = 99/98/99 for the ‘Gladiator frogs’ group H. multifasciata, H. raniceps, H. calcarata, H. fasciata, H. dentei, H. geographica, H. boans, H. ornatissima). Furthermore, the species Phrynohyas was the sister group to Osteocephalus (BP = 61/86/99). We observed the homophyly of the Centrolenidae (BP = 83/90/100), which was the sister group to the Hylidae, but this topology was only supported in NJ. On a lower systematic level, we noted that the Hyla geographica and the H. nana species group are paraphyletic. Indeed H. geographica clustered with H. boans and H. sp.1 with H. minuscula with high bootstrap supports.

3.1.2 Genetic diversity of the 16S rRNA and 12S rRNA genes

Considering the homogeneity between the two partitions (12S and 16S) and the correlation coefficient between the two distance matrices (0.837), we estimated the genetic variability [63] using the complete dataset. According to the Tamura–Nei genetic distance alpha = 0.30 (Table 3), the variability between the different genera of family Hylidae ranged from 0.129±0.019 to 0.852±0.151. The genetic divergence between the Centrolenidae (Hyalinobatrachium and Cochranella) and the Hylidae ranged from 0.279±0.041 with Phrynohyas to 0.685±0.125 with Phyllomedusa. The genus Scinax displayed a within group average of 0.417±0.067 (data not shown) and the genus Hyla yielded an average of 0.392±0.05. Genetic diversity within the two clades was respectively 0.223±0.026 (Hyla 30-chromosome group) and 0.278±0.03 (‘gladiator frogs’). The diversity within the genus Hyla is huge, but we need to reconsider this result in light of the polyphyletic pattern of this group. The genetic diversity between the two groups of Hyla was 0.512±0.078 and the variability between the two groups of Scinax was 0.556±0.109. By comparison, the genetic diversity between Osteocephalus and Phrynohyas is equal to 0.129±0.019. These results were corroborated by the mismatch analyses (Table 5), which revealed no congruence between the taxonomic levels (subfamily and family) and the molecular features.

Table 3

Between group average using the Tamura–Nei (alpha parameter for the gamma shape equal to 0.30) for the seven genera standard errors estimated by bootstrap method (1000 replications) for the 16S and 12S mitochondrial DNA (813 bp)

1 2 3 4 5 6 7
[1] Hyla 0.048 0.068 0.064 0.102 0.124 0.153
[2] Phrynohyas 0.371 0.019 0.041 0.092 0.078 0.111
[3] Osteocephalus 0.466 0.129 0.066 0.102 0.081 0.156
[4] Centrolenidae 0.490 0.279 0.382 0.102 0.125 0.123
[5] Scinax 0.683 0.529 0.590 0.646 0.151 0.258
[6] Phyllomedusa 0.785 0.453 0.495 0.685 0.852 0.218
[7] Eleutherodactylus 0.866 0.624 0.707 0.648 1.188 0.985
Table 5

Test of the homogeneity between the different mismatch distributions using the Kolmogorov–Smirnov test with alpha equal to 0.05 (see text for more details)

2 Within Genus Hyla Within Genus Scinax Within Hylinae Between Hylinae-Phyllomedusinae Between Hylidae-Centrolenidae
1
Within Genus Hyla 1>2 1<2 1<2 1<2
Within Genus Scinax NS 1<2 1<2 1<2
Within Hylinae 1>2 1>2 1<2 1<2
Between Hylinae-Phyllomedusinae 1>2 1>2 1<2 1>2
Between Hylidae-Centrolenidae 1>2 NS 1<2 NS

The genetic diversity between the different genera within the subfamily Hylinae was significantly higher than that estimated between the subfamilies Hylinae and Phyllomedusinae. A similar result was found when the genetic diversity within the subfamily Hylinae was compared with that estimated between the families Hylidae and Centrolenidae.

Moreover, we found no significant difference between the genetic diversity within the genus Scinax and the genetic diversity between the families Hylidae and Centrolenidae. However, this pattern could be due to saturation effects.

3.2 Combined analysis of nuclear datasets

The incongruence test did not detect significant heterogeneity between the two nuclear datasets (p=0.94) and no saturation was observed for the transition and transversion substitution patterns (Fig. 2B, D, F). Of the 1590 positions, 221 were informative (gaps were treated as missing for the unweighted parsimony analysis). We found 192 equiparsimonious tree (623 steps). The g1 value was −0.68, the CI was equal to 0.594, the RI was equal to 0.797.

Considering the Eleutherodactylus species as outgroup, we observed the homophyly of the Centrolenidae (BP = 99/97/99) (Fig. 4). Moreover, these species were sister groups to the Hylidae, which constituted a homophyletic group (BP = 79/–/69). Within French Guiana Hylidae, we observed that the genus Phyllomedusa (Phyllomedusinae) was the sister group to the subfamily Hylinae (BP = 78/92/93). Within the Hylinae, the genus Scinax was homophyletic (BP = 100/100/100). The rostrata species groups constituted by Scinax jolyi, Scinax proboscideus, Scinax rostrata and Scinax nebulosa (BP = 100/100/100) and the rubra species group (BP = 61/58/–) were supported.

Fig. 4

Bootstrap analyses carried out with 1000 iterations using the 1590 pb of the tyrosinase and 18S rDNA among 38 ‘species’ of Hyla, Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, Cochranella and Hyalinobatrachium genera: Maximum-Likelihood using bootstrap value on the left, Maximum-Parsimony bootstrap value on the middle, Neighbour-Joining on a matrix of the Tamura–Nei (alpha = 0.21) model right bootstrap value. The Maximum-Likelihood tree is shown (−ln=5853.9177). The tree was rooted on Eleutherodactylus as outgroup. The arrow indicated the incongruence for one node between the Maximum-Likelihood tree and the three bootstrapped trees (ML, MP, NJ). Masquer

Bootstrap analyses carried out with 1000 iterations using the 1590 pb of the tyrosinase and 18S rDNA among 38 ‘species’ of Hyla, Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, Cochranella and Hyalinobatrachium genera: Maximum-Likelihood using bootstrap value on ... Lire la suite

The paraphyly of genus Hyla was supported by ML, MP, and NJ methods (BP = 52/56/55), due to the relationship between the homophyletic group constituted by Osteocephalus and Phrynohyas species and the Hyla 30-chromosome group bp = 97/94/99). The homophyly of the two groups of Hyla was confirmed by the ‘nuclear total evidence’ approach (BP = 95/88/97 for the 30-chromosome Hyla and bp = 90/93/99 for the Gladiator frogs. Paraphyly of the H. geographica species group and the nana species group are confirmed. For the second group, this paraphyly is not supported.

3.2.1 Genetic diversity of the Tyrosinase and 18S rDNA genes

According to the Tamura–Nei distance with alpha = 0.21 (Table 4), the variability between the different genera of Hylidae ranged from 0.014±0.003 to 0.089±0.009. The genetic divergence between the Centrolenidae (Hyalinobatrachium and Cochranella) and the Hylidae ranged from 0.045±0.006 with Phrynohyas to 0.080±0.009 with Phyllomedusa. The genus Scinax displayed a within group average of 0.026±0.003 (data not shown) and the genus Hyla yielded an average of 0.030±0.003. Genetic diversity within the two groups of Hyla was respectively 0.016±0.002 for 30-chromosome Hyla, and 0.018±0.003 for Gladiator frogs. The genetic diversity between the two groups was 0.04±0.006 and the variability between the two groups of Scinax was equal to 0.032±0.004. By comparison, the genetic diversity between Osteocephalus and Phrynohyas is only 0.014±0.003.

Table 4

Between group average using the Tamura–Nei (alpha parameter for the gamma shape equal to 0.21) for the seven genera standard errors estimated by bootstrap method 1000 replications for the 18S and Tyrosinase nuclear DNA (1590 pb)

1 2 3 4 5 6 7
[1] Hyla 0.004 0.003 0.006 0.005 0.008 0.008
[2] Phrynohyas 0.032 0.003 0.006 0.005 0.010 0.008
[3] Osteocephalus 0.032 0.014 0.006 0.005 0.010 0.009
[4] Centrolenidae 0.049 0.045 0.046 0.007 0.009 0.006
[5] Scinax 0.051 0.042 0.039 0.058 0.009 0.009
[6] Phyllomedusa 0.079 0.083 0.085 0.080 0.089 0.011
[7] Eleutherodactylus 0.066 0.063 0.066 0.055 0.073 0.091

Pairwise comparison showed that genetic diversity was significantly higher between the two different subfamilies Hylidae (Hylinae and Phyllomedusinae) than between the families Hylidae and Centrolenidae, which is another incongruence between morphology and molecular data (Table 5).

3.3 Combined analysis of total datasets (nuclear and mitochondrial)

The incongruence test did not detect significant heterogeneity between the two partition (mitochondrial versus nuclear p=0.09) and weak saturation was observed for the mitochondrial versus nuclear substitution patterns (Fig. 2G–I). Of the 2403 positions, 615 were informative (gaps were treated as missing for the unweighted parsimony analysis). We found one single parsimonious tree (2674 steps). The g1 value was –0.79, the CI was equal to 0.430, and RI was equal to 0.662.

Combined nuclear and mitochondrial analysis confirmed the previous results: paraphyly of the genus Hyla and the relationship between Phrynohyas and Osteocephalus with the Hyla 30 chromosomes group (Fig. 5). The genus Scinax was the sister group to Hyla plus Osteocephalus plus Phrynohyas; however, this topology was not supported. The Phyllomedusinae was the sister group to the Hylinae (55/90/88).

Fig. 5

Bootstrap analyses carried out with 1000 iterations using the 2403 pb of the mitochondrial and nuclear genes among 38 ‘species’ of Hyla, Osteocephalus, Scinax, Phrynohyas, Phyllomedusa, Cochranella and Hyalinobatrachium genera: Maximum-Likelihood using bootstrap value on the left, Maximum-Parsimony bootstrap value on the middle, Neighbour-Joining on a matrix of the Tamura–Nei (alpha = 0.25) model right bootstrap value. The Maximum-Likelihood tree is shown (−ln=15 785.73299). The tree was rooted on Eleutherodactylus as outgroup.

4 Discussion

4.1 The genus Hyla

Our results confirmed that two major groups constitute the paraphyletic genus Hyla in French Guiana. The first group is constituted by H. brevifrons, H. leucophyllata, H. nana, H. minuta, H. sp1 and H. minuscula and the second group by H. boans, H. fasciata, H. calcarata, H. dentei, H. geographica, H. raniceps, H. multifaciata and H. ornatissima. These species represent the 30-chromosome Hyla group [9] and the second one the Gladiator frogs, respectively groups [26]. The paraphyly of the genus Hyla confirmed herein underlines the necessity to reconsider the taxonomy of one of these group.

We detected incongruence between the mitochondrial and the nuclear gene trees. Indeed, the genera Osteocephalus and Phrynohyas clustered with the genus Hyla on the nuclear gene tree. This pattern was different considering the mitochondrial gene tree but the bootstrap values are too low and thus might be due to saturation and homoplasy on mitochondrial data. These nuclear gene results were in agreement with the tree constructed on the basis of morphology by Da Silva [27], which revealed two groups in the paraphyletic genus Hyla. The first group (2n=30) was polyphyletic according to the analysis by Da Silva (Hyla + Phyllodytes + Xenohyla) and the node for the second group (2n=24) was not supported by the synapomorphy of this group, i.e., shape of the first distal prepollex nearly cylindrical (CI = 0.033); four elements anterior to the distal prehallux (CI = 0.088). However, our results add information on the phylogenetic relationships between ‘Gladiator frogs’, Scinax, Hyla 30 chromosomes and Osteocephalus + Phrynohyas.

We found that the clustering of H. sp1 with H. minuscula (with 3% divergence) is in agreement with their acoustic signals [19]. A more accurate phylogenetic analysis coupling systematics and phylogeography of these particular groups needs to be done, as for the H. leucophyllata complex [9].

4.2 The genus Scinax

The molecular homophyly [64] of Scinax was supported by high bootstrap proportions, whatever the molecular marker used. The molecular results were in agreement with the morphological results based on a single shared derived trait, i.e., the absence of, or reduced webbing between toes I and II in adults [65] and on ten synapomorphies [29].

The phylogenetic reconstruction indicated that the rubra group (S. rubra, S. cruentomma, S. boesemani, S. elaeochroa) and the rostrata group (S. jolyi, S. proboscideus, S. rostrata and S. nebulosa) are respectively homophyletic. This result is in contradiction with the morphological cladistic analysis made by Faivovich [29] in which the author stated the nesting of the rostrata group within the rubra species group. Hierarchical positions of the species of the rubra group are also incongruent with the topology proposed by Faivovich. However this could be due to taxa sampling. According to the Tamura–Nei distance, genetic variation within Scinax was 0.417±0.067 for the total mitochondrial DNA alignment. A previous study based on the partial 16S [28] displayed a genetic variation within Scinax to 0.171±0.016. Our results indicate a higher degree of genetic diversity (whatever the distance and the marker used) within a restricted sample of Scinax than other studies [66]. Indeed, Kosuch et al. [67] found 8 to 10% of genetic divergence in the 16S rDNA gene among the different species (African + Asian species) belonging to the genus Hoplobatrachus and 11% between the Asian species Rana gracilis and the African species R. lepus. This analysis of the genetic divergence should be considered in light of:

  • (1) the varied pattern of substitutions along the 16S rDNA molecule that could result in over or under-estimation of genetic distances depending on the portion of the gene studied, and
  • (2) the homogeneity/heterogeneity of this pattern of substitutions between the lineages.
We eliminated the first artefact by using a homologous region of the 16S rDNA gene. To account for the second, we constructed a NJ tree rooted on the Xenopus laevis sequence and found no significant difference in the rate of substitution between the different lineages (data not shown). These results demonstrate the long evolutionary history of the genus Scinax. This supports the opinion of Pombal et al. [25] (with respect to morphology, and ecology) who suggested that the genera Scinax and Hyla need to be separated into several genera.

4.3 Molecular vs morphological taxonomic levels

In the case of congruence between morphological and molecular data, it is clear that the genetic diversity within lower taxonomic levels will be lower than that within higher taxonomic levels. Nevertheless, Hylidae and Hylinae are supported as homophyletic with respect to the positions of Centrolenidae and Pyllomedusinae. These families and sub families level are thus corroborated. The mitochondrial unresolved pattern is certainly biased because of strong saturation and homoplasy. The heterogenity in branch length and distances between Centrolenidae, Hylinae and Phyllomedusinae for mitochondrial and nuclear data (no significant differences between the genetic distances of the two families Hylidae and Centrolenidae and the genus Scinax) is certainly due to heterogeneous rate of molecular evolution.

Our results (Table 5) clearly show that the phylogenetic signals based on mitochondrial genes and nuclear genes are not congruent. This incongruence could be due to the saturation effect. The mitochondrial genes displayed two patterns:

  • (1) the first was observed at the family level, as some Hylinae species (Osteocephalus and Phrynohyas) clustered with the subfamily Phyllomedusinae (with no support).
  • (2) The second pattern was due to the homophyletic genus Scinax (considering the two species groups present in French Guiana), which displayed similar degree of genetic diversity than the genus Hyla, which was paraphyletic according to total evidence analysis.

This extreme difference in mitochondrial and nuclear diversity may be the result of numerous phenomena, as listed by Avise [68]. It seems therefore obvious that the genus Scinax represents a genus of a long evolutionary history, given that the sampling effort was identical for the two genera in this region.

5 Conclusion

Strategies for the protection of biological diversity require the identification of areas that shelter the highest species and genetic diversity, and maximal protection of contiguous environmental gradients within these areas [69]. It will be very difficult to protect neotropical frogs efficiently, if only a few clades have been validated using molecular markers. A recent study using molecular markers [42] revealed evidence of striking convergences in larval and adult traits for the Madagascan and Asian Ranidae. The level of homoplasy in morphological, ecological and physiological data for the Neobatrachia is still underestimated and amphibian systematic is largely still based on morphological traits. These lead to an underestimation of the biodiversity within amphibians. Moreover, it is very important to use both mitochondrial and nuclear markers to avoid incongruence between gene trees and species trees in molecular phylogenetic reconstructions.

Indeed, the level of genetic diversity between genera within the same subfamily can vary considerably. For example, the genera Scinax and Hyla displayed a mitochondrial genetic diversity of 0.417±0.067 and 0.392±0.050, whereas Osteocephalus and Phrynohyas yielded a value of 0.129±0.019. This can be interpreted in two ways: the genera Scinax and Hyla must be split into more than one genus (due to the high genetic distance), or the genera Osteocephalus and Phrynohyas must be merged into only one genus (due to the small genetic distance). Considering the phylogenetic relationships within the Hylidae, i.e., homophyly of Scinax, paraphyly of Hyla, and the nuclear genetic diversity, the first hypothesis seems more likely.

The species identified on the basis of morphology could be an indicator of species richness but certainly underestimate the real number of specific entity especially in the tropics [11]. Another approach, DNA bar-coding, was recently proposed by Hebert [70]. This methodology use large scale screening of one or a few reference genes in order to assign unknown individuals to species and thereby could enhance discovery of new species. However, some authors raise doubts about the contribution of this approach [71]. For example, problems may arise in groups of frequent hybridisation and recent radiations. The real challenge lies with tropical taxa and those with limited dispersal and thus substantial phylogeographic structure [71].

Considering our results, the fact that a complete inventory of amphibians in French Guiana is currently impractical and the fact that populations are declining in many parts of the world, we recommend that species richness should be initially assessed on the basis of morphology, systematically coupled with a study of molecular genetic diversity (nuclear and mitochondrial gene sequences). The higher taxonomic diversity must be coupled to phylogenetic diversity for the conservation: “all genera (based on morphology) are equal but some genera are more equal than others (based on molecular).” This approach will avoid major biases in the estimation of the biodiversity in neotropical regions, therefore providing an important conservation tool.

Acknowledgements

We are grateful to Jean-François Martin, Anne Miquelis and Nicolas Pech for useful comments on the manuscript, and Michel Blanc for the Cochranella species and H. boans. This work was supported by a grant from the French ‘Ministère de l’Écologie et du Développement durable'. The manuscript was revised by Alex Edelman & associates.


Bibliographie

[1] S.E. Willams; J.M. Hero Multiple determinants of Australian tropical frog biodiversity, Biol. Conserv., Volume 98 (2001), pp. 1-10

[2] A. Purvis; A. Hector Getting the measure of biodiversity, Nature, Volume 405 (2000), pp. 212-219

[3] P.H. Willams; C.J. Humphries; R.J. Vane-Wright Centres of seed-plant diversity: the family way, Proc. R. Soc. Lond. Biol., Volume 256 (1994), pp. 67-70

[4] P.H. Willams; K.J. Gaston; C.J. Humphries Mapping biodiversity value worldwide: combining higher-taxon richness from different groups, Proc. R. Soc. Lond. Biol., Volume 264 (1997), pp. 141-148

[5] D.P. Faith Phylogenetic pattern and the quantification of organismal biodiversity, Phil. Trans. R. Soc. Lond., Ser. B – Biol., Volume 345 (1994), pp. 45-58

[6] C. Moritz; D.P. Faith Comparative phylogeography and the identification of genetically divergent areas for conservation, Mol. Ecol., Volume 7 (1998), pp. 419-429

[7] W.J. Kress; W.R. Heyer; P. Acevedo; J. Coddington; D. Cole; T.L. Erwin; B.J. Meggers; M. Pogue; R.W. Thorington; R.P. Vari; M.J. Weitzman; S.H. Weitzman Amazonian biodiversity: assessing conservation priorities with taxonomic data, Biol. Conserv., Volume 7 (1998), pp. 1577-1587

[8] K.J. Gaston; P.H. Williams Spatial patterns in taxonomic diversity (K.J. Gaston, ed.), Biodiversity of Numbers and Difference, Blackwell Science Mississauga, Ontario, Canada, 1996, pp. 202-229

[9] A.A. Chek; S.C. Lougheed; P.T. Boag Perception and history: molecular phylogeny of a diverse group of neotropical frogs, the 30-chromosome Hyla (Anura: Hylidae), Mol. Phylogenet. Evol., Volume 18 (2001), pp. 370-385

[10] B.E. Young; S.N. Stuart; J.S. Chanson; N.A. Cox; T.M. Boucher Disappearing jewels: the status of new world amphibians, NatureServe (2004), pp. 1-60

[11] M. Meegaskumbura; F. Bossuyt; R. Pethiyagoda; K. Manamendra-Arachchi; M. Bahir; M.C. Milinkovitch; C.J. Schneider Sri Lanka: an amphibian hot spot, Science, Volume 298 (2002), p. 379

[12] A.R. Blaustein; D.B. Wake Declining amphibians populations: a global phenomenon?, Trends Ecol. Evol., Volume 5 (1990), pp. 203-204

[13] S.N. Stuart; J.S. Chanson; N.A. Cox; B.E. Young; A.S.L. Rodrigues; D.L. Fischman; R.W. Waller Status and trends of amphibian declines and extinctions worldwide, Science, Volume 306 (2004), pp. 1783-1786

[14] J.E. Houlahan; C.S. Findlay; B.R. Schmidt; A.H. Meyers; S.L. Kuzmin Quantitative evidence for global amphibian population declines, Nature, Volume 404 (2000), pp. 752-755

[15] J.M. Kiesecker; A.R. Blaustein; L.K. Belden Complex causes of amphibian population declines, Nature, Volume 410 (2001), pp. 681-684

[16] C. Azvedo-Ramos; U. Galatti Patterns of amphibian diversity in Brazilian Amazonia: conservation implications, Biol. Conserv., Volume 103 (2002), pp. 103-111

[17] W.E. Duellman Distribution pattern of amphibians in South America (W.E. Duellman, ed.), Patterns of Distribution of Amphibians: A Global Perspective, The Johns Hopkins University Press, Baltimore, 1999, pp. 255-328

[18] W.R. Heyer On frog distribution patterns east of the Andes (P.E. Vanzolini; W.R. Heyer, eds.), Proceeding of a Workshop on Neotropical Distribution Patterns, Academia Brasileira de Ciencias, Rio de Janeiro, 1998, pp. 225-273

[19] J. Lescure; C. Marty Atlas des amphibiens de Guyane, Patrimoines Naturels, vol. 45, Muséum national d'histoire naturelle, Paris, 2000

[20] L.S. Ford; D.C. Cannatella The major clades of frogs, Herpetol. Monogr., Volume 7 (1993), pp. 94-117

[21] J. Lescure; V. Marty; C. Marty; M. Auber-Thomas Contribution à l'étude des amphibiens de Guyane française – XI, Les Phrynohyas Anura Hylidae, Rev. Fr. Aquar. Herpétol., Volume 23 (1996), pp. 69-76

[22] J. Lescure; V. Marty; C. Marty; M. Auber-Thomas; F. Letellier; F. Starace Contribution à l'étude des amphibiens de Guyane française – X, Les Phyllomedusa Anura Hylidae, Rev. Fr. Aquar. Herpétol., Volume 22 (1995), pp. 35-50

[23] J.A. Campbell Distribution pattern of amphibians in Middle America (W.E. Duellman, ed.), Patterns of Distribution of Amphibians: A Global Perspective, The Johns Hopkins University Press, Baltimore, 1999, pp. 111-210

[24] W.E. Duellman Evolution of hylids frogs (W.E. Duellman, ed.), The Hylid Frogs of Middle America, 2 vols., Museum of Natural History, University of Kansas, 2001, pp. 765-787

[25] J.P. Pombal; C.F.B. Haddad; S.A. Kasahara New species of Scinax (Anura, Hylidae) from Southeastern Brazil, with comments on the Genus, J. Herpetol., Volume 29 (1995), pp. 1-6

[26] A.G. Kluge The gladiator frogs of Middle America and Colombia – A reevaluation of their systematics (Anura: Hylidae), Occas. Pap. Mus. Zool., Univ. Mich., Volume 688 (1979), p. 24

[27] H.R. Da Silva, Phylogenetic relationships of the family Hylidae with emphasis on the relationships within the subfamily Hylinae (Amphibia: Anura), PhD thesis, University Kansas–Lawrence, 1998

[28] M.D. Salducci; C. Marty; R. Chappaz; A. Gilles Molecular phylogeny of French Guiana Hylinae: implications for the systematic and biodiversity of the neotropical frogs, C. R. Biologies, Volume 325 (2002), pp. 141-153

[29] J. Faivovich A cladistic analysis of Scinax Anura: Hylidae, Cladistics, Volume 18 (2002), pp. 367-393

[30] W.E. Duellman; J.J. Wiens The status of the hylid frog genus Ololygon and the recognition of Scinax Wagler 1830, Occas. Pap. Mus. Nat. Hist. Univ. Kansas, Volume 151 (1992), pp. 1-23

[31] J.M. Hay; I. Ruvinsky; S.B. Hedges; L.R. Maxson Phylogenetic relationships of amphibian families inferred from DNA sequences of mitochondrial 12S and 16S ribosomal RNA genes, Mol. Biol. Evol., Volume 12 (1995), pp. 928-937

[32] I. Ruvinsky; L.R. Maxson Phylogenetic relationships among bufonoid frogs (Anura: Neobatrachia) inferred from mitochondrial DNA sequences, Mol. Phylogenet. Evol., Volume 5 (1996), pp. 533-547

[33] D.C. Cannatella; D.M. Hillis; P.T. Chippindale; L. Weigt; A.S. Rand; M.J. Ryan Phylogeny of frogs of the Physalaemus pustulosus species group with an examination of data incongruence, Syst. Biol., Volume 47 (1998), pp. 311-335

[34] C.R. Darst; D. Cannatella Novel relationships among hyloid frogs inferred from 12S and 16S mitochondrial DNA sequences, Mol. Phylogenet. Evol., Volume 31 (2003), pp. 462-475

[35] W. Liu; A. Lathrop; J. Fu; D. Yang; R.W. Murphy Phylogeny of East Asian Bufonids inferred from mitochondrial DNA sequences (Anura: Amphibia), Mol. Phylogenet. Evol., Volume 14 (2000), pp. 423-435

[36] M. Vences; J. Kosuch; S. Lötters; A. Widmer; K.H. Jungfer; J. Köhler; M. Veith Phylogeny and classification of poison frogs (Amphibia: Dendrobatidae) based on mitochondrial 16S and 12S ribosomal RNA gene sequences, Mol. Phylogenet. Evol., Volume 15 (2000), pp. 34-40

[37] D.J. Harris Reevaluation of 16S ribosomal RNA variation in Bufo (Anura: Amphibia), Mol. Phylogenet. Evol., Volume 19 (2001), pp. 326-329

[38] F. Bossuyt; M.C. Milinkovitch Amphibians as indicators of early Tertiary ‘Out of India’ dispersal of vertebrates, Science, Volume 292 (2001), pp. 93-95

[39] J.D. Austin; S.C. Lougheed; K. Tanner; A.A. Check; J.P. Bogart; P.T. Boag A molecular perspective on evolutionary affinities of enigmatic neotropical frog Allophryne ruthveni, Zool. J. Linn. Soc., Volume 134 (2002), pp. 335-346

[40] K. Roelants; J. Jiang; F. Bossuyt Endemic ranid (Amphibia: Anura) genera in southern mountain ranges of the Indian subcontinent represent ancient frog lineages: evidence from molecular data, Mol. Phylogenet. Evol., Volume 31 (2004), pp. 730-740

[41] P. Taberlet; J. Bouvet A single plucked feather as a source of DNA for bird genetic studies, AUK, Volume 108 (1991), p. 58

[42] F. Bossuyt; M.C. Milinkovitch Convergent adaptative radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits, Proc. Natl Acad. Sci. USA, Volume 97 (2000), pp. 6585-6590

[43] A. Miquelis; J.F. Martin; E.W. Carson; G. Brun; A. Gilles Performance of 18S rDNA helix E23 for phylogenetic relationships within and between the Rotifera-Acanthocephala clade, C. R. Biologies, Volume 323 (2000), pp. 925-941

[44] A. Gilles; R. Chappaz; L. Cavalli; M. Lörtscher; E. Faure Genetic differentiation and introgression between putative subspecies of Leuciscus soufia Teleostei: Cyprinidae of the region of the Mediterranean Alps, Can. J. Fish. Aquat. Sci., Volume 55 (1998), pp. 2341-2354

[45] J.D. Thompson; T.J. Gibson; F. Plewniak; F. Jeanmougin; D.G. Higgins The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools, Nucleic Acids Res., Volume 24 (1997), pp. 4876-4882

[46] Y. Van de Peer; A. Caers; P. De Rijk; R. De Wachter Database on the structure of small ribosomal subunit RNA, Nucleic Acids Res., Volume 26 (1998), pp. 179-182

[47] A. Löytynoja; M.C. Milinkovitch SOAP cleaning multiple alignments from unstable blocks, Bioinformatics, Volume 17 (2001), pp. 573-574

[48] H. Philippe MUST: a computer package of management utilities for sequences and trees, Nucleic Acids Res., Volume 21 (1993), pp. 5264-5272

[49] N. Saitou; M. Nei The neighbor-joining method: a new method for reconstructing phylogenetic trees, Mol. Biol. Evol., Volume 4 (1987), pp. 406-425

[50] K. Tamura; M. Nei Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees, Mol. Biol. Evol., Volume 10 (1993), pp. 512-526

[51] D.L. Swofford, Phylogenetic analysis using parsimony, PAUP version 40, Sinauer Sunderland, MA, 1998

[52] D. Posada; K.A. Crandall MODELTEST: testing the model of DNA substitution, Bioinformatics, Volume 14 (1998), pp. 817-818

[53] J.S. Rogers; D.L. Swofford A fast method for approximating maximum likelihoods of phylogenetic trees from nucleotide sequences, Syst. Biol., Volume 47 (1998), pp. 77-89

[54] J.S. Farris; M. Kallersjö; A. Kluge; C. Bult Testing significance of congruence, Cladistics, Volume 10 (1995), pp. 315-320

[55] C.W. Cunningham Can three incongruence test predict when data should be combined?, Mol. Biol. Evol., Volume 14 (1997), pp. 733-740

[56] C.W. Cunningham Is incongruence between data partitions a reliable predictor of phylogenetic accuracy?, Syst. Biol., Volume 46 (1997), pp. 464-478

[57] A. Gilles; G. Lecointre; A. Miquelis; M. Loerstcher; R. Chappaz; G. Brun Partial combination applied to phylogeny of European cyprinids using the mitochondrial control region, Mol. Phylogenet. Evol., Volume 19 (2001), pp. 22-33

[58] P. Darlu; G. Lecointre When does the incongruence length difference test fail?, Mol. Biol. Evol., Volume 19 (2002), pp. 432-437

[59] M. Dowton; A.D. Austin Increased congruence does not necessarily indicate increased phylogenetic accuracy – the behavior of the incongruence length difference test in mixed-model analyses, Syst. Biol., Volume 51 (2002), pp. 19-31

[60] A.R. Templeton Convergent evolution and non-parametric inferences from restriction fragment and DNA sequence data (B. Weir, ed.), Statistical Analysis of DNA Sequence Data, Marcel Dekker, New York, 1983, pp. 151-179

[61] H. Shimodaira; M. Hasegawa Multiple comparisons of log-likelihoods with applications to phylogenetic inference, Mol. Biol. Evol., Volume 16 (1999), pp. 1114-1116

[62] S. Kumar PHYLTEST: A Program for Testing Phylogenetic Hypotheses, Institute of Molecular Evolutionary Genetics, The Pennsylvania State University, University Park, Pennsylvania, USA, 1996 (version 20 [computer software and manual])

[63] S. Kumar; K. Tamura; I.B. Jakobsen; M. Nei MEGA2: Molecular Evolutionary Genetics Analysis software, Bioinformatics, Volume 17 (2001), pp. 1244-1245

[64] M. Delorme; A. Dubois; J. Kosuch; M. Vences Molecular phylogenetic relationships of Lankanectes corrugatus from Sri Lanka: endemism of South Asian frogs and the concept of monophyly in phylogenetic studies, Alytes, Volume 22 (2004), pp. 53-64

[65] A.M. Suarez-Moyorga; J.D. Lynch Redescription of the Tadpole of Hyla vigilans (Anura: Hylidae) and notes about possible taxonomic relationships, Caribb. J. Sci., Volume 37 (2001), pp. 116-119

[66] M. Vences; M. Thomas; A. Meijden; Y. Chiari; D. Vieites Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians, Front. Zool., Volume 2 (2005), pp. 1-12

[67] J. Kosuch; M. Vences; A. Dubois; A. Ohler; W. Böhme Out of Asia: Mitochondrial DNA evidence for an oriental origin of tiger frogs genus Hoplobatrachus, Mol. Phylogenet. Evol., Volume 21 (2001), pp. 398-407

[68] J.C. Avise Phylogeography: The History and Formation of Species, Harvard University Press, Cambridge, MA, 2000

[69] C. Moritz Strategies to protect biological diversity and the evolutionary processes that sustain it, Syst. Biol., Volume 51 (2002), pp. 238-254

[70] P.D.N. Hebert; A. Cywinska; S.L. Ball; J.R. deWaard Biological identifications through DNA barcodes, Proc. R. Soc. Lond., Ser. B, Volume 270 (2003), pp. 313-321

[71] C. Moritz; C. Cicero DNA barcoding: promise and pitfalls, PloS Biology, Volume 2 (2004), pp. 1529-1531

[72] Y. Chang; F. Huang; T. Lo The complete nucleotide sequence and gene organisation of carp Cyprinus carpio mitochondrial genome, J. Mol. Evol., Volume 38 (1994), pp. 138-155

[73] T. Kocher; W. Thomas; A. Meyer; S. Edwards; S. Pääbo; F. Villablanca; A.C. Wilson Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers, Proc. Natl Acad. Sci. USA, Volume 86 (1989), pp. 6196-6200

[74] A.M. Goebel; J.M. Donnelly; M.E. Atz PCR primers and amplification methods for 12S ribosomal DNA the control region cytochrome oxydase I and cytochrome b in bufonids and other frogs and an overview of PCR primers which have amplified DNA in amphibians successfully, Mol. Phylogenet. Evol., Volume 11 (1999), pp. 163-199


Cité par

  • Katyuscia Araujo-Vieira; Ana Carolina C. Lourenço; João Victor A. Lacerda; Mariana L. Lyra; Boris L. Blotto; Santiago R. Ron; Diego Baldo; Martín O. Pereyra; Ángela M. Suárez-Mayorga; Délio Baêta; Rodrigo Barbosa Ferreira; César L. Barrio-Amorós; Claudio Borteiro; Reuber A. Brandão; Cinthia A. Brasileiro; Maureen A. Donnelly; Marcos J. M. Dubeux; Jörn Köhler; Francisco Kolenc; Felipe Sá Fortes Leite; Natan M. Maciel; Ivan Nunes; Victor G. D. Orrico; Pedro Peloso; Tiago L. Pezzuti; Steffen Reichle; Fernando J. M. Rojas-Runjaic; Helio R. Da Silva; Marcelo J. Sturaro; José A. Langone; Paulo C. A. Garcia; Miguel Trefaut Rodrigues; Darrel R. Frost; Ward C. Wheeler; Taran Grant; José P. Pombal; Célio F. B. Haddad; Julián Faivovich Treefrog Diversity in the Neotropics: Phylogenetic Relationships of Scinaxini (Anura: Hylidae: Hylinae), South American Journal of Herpetology, Volume 27 (2023) no. sp1 | DOI:10.2994/sajh-d-22-00038.1
  • Miquéias Ferrão; Jiří Moravec; Anthony S. Ferreira; Leandro J. C. L. Moraes; James Hanken A NEW SNOUTED TREEFROG OF THE GENUS SCINAX (ANURA, HYLIDAE) FROM THE WHITE-SAND FORESTS OF CENTRAL AMAZONIA, Breviora, Volume 573 (2022) no. 1 | DOI:10.3099/0006-9698-573.1.1
  • Antoine Fouquet; Pedro Peloso; Rawien Jairam; Albertina P. Lima; Alexander T. Mônico; Raffael Ernst; Philippe J. R. Kok Back from the deaf: integrative taxonomy revalidates an earless and mute species, Hylodes grandoculis van Lidth de Jeude, 1904, and confirms a new species of Pristimantis Jiménez de la Espada, 1870 (Anura: Strabomantidae) from the Eastern Guiana Shield, Organisms Diversity Evolution, Volume 22 (2022) no. 4, p. 1065 | DOI:10.1007/s13127-022-00564-w
  • Victor G.D. Orrico; Taran Grant; Julian Faivovich; Mauricio Rivera‐Correa; Marco A. Rada; Mariana L. Lyra; Carla S. Cassini; Paula H. Valdujo; Walter E. Schargel; Denis J. Machado; Ward C. Wheeler; Cesar Barrio‐Amorós; Daniel Loebmann; Jiří Moravec; Juliana Zina; Mirco Solé; Marcelo J. Sturaro; Pedro L.V. Peloso; Pablo Suarez; Célio F.B. Haddad The phylogeny of Dendropsophini (Anura: Hylidae: Hylinae), Cladistics, Volume 37 (2021) no. 1, p. 73 | DOI:10.1111/cla.12429
  • Raffael Ernst; Christian Kehlmaier; Ninda L. Baptista; Pedro Vaz Pinto; Makaya Futuro Branquima; Maël Dewynter; Antoine Fouquet; Annemarie Ohler; Andreas Schmitz Filling the gaps: The mitogenomes of Afrotropical egg-guarding frogs based on historical type material and a re-assessment of the nomenclatural status of Alexteroon Perret, 1988 (Hyperoliidae), Zoologischer Anzeiger, Volume 293 (2021), p. 215 | DOI:10.1016/j.jcz.2021.06.002
  • Jean‐Pierre Vacher; Jérôme Chave; Francesco Gentile Ficetola; Guilhem Sommeria‐Klein; Shengli Tao; Christophe Thébaud; Michel Blanc; Agustín Camacho; José Cassimiro; Timothy J. Colston; Maël Dewynter; Raffael Ernst; Philippe Gaucher; Jerriane Oliveira Gomes; Rawien Jairam; Philippe J. R. Kok; Jucivaldo Dias Lima; Quentin Martinez; Christian Marty; Brice P. Noonan; Pedro M. Sales Nunes; Paul Ouboter; Renato Recoder; Miguel Trefaut Rodrigues; Andrew Snyder; Sérgio Marques-Souza; Antoine Fouquet Large‐scale DNA‐based survey of frogs in Amazonia suggests a vast underestimation of species richness and endemism, Journal of Biogeography, Volume 47 (2020) no. 8, p. 1781 | DOI:10.1111/jbi.13847
  • Valeria D. Chasiluisa; Marcel A. Caminer; Andrea Varela-Jaramillo; Santiago R. Ron Description and phylogenetic relationships of a new species of treefrog of theOsteocephalus buckleyispecies group (Anura: Hylidae), Neotropical Biodiversity, Volume 6 (2020) no. 1, p. 21 | DOI:10.1080/23766808.2020.1729306
  • Patrizia Cesare; Antonella Bonfigli; Michele Miranda; Anna Maria Poma; Sabrina Colafarina; Osvaldo Zarivi Transcriptional analysis of tyrosinase gene expression during Bufo bufo development, Saudi Journal of Biological Sciences, Volume 26 (2019) no. 1, p. 8 | DOI:10.1016/j.sjbs.2016.10.018
  • Miquéias Ferrão; Jiří Moravec; Igor Luis Kaefer; Rafael de Fraga; Albertina Pimentel Lima New Species ofScinax(Anura: Hylidae) with Red-Striped Eyes from Brazilian Amazonia, Journal of Herpetology, Volume 52 (2018) no. 4, p. 472 | DOI:10.1670/17-165
  • Santiago R. Ron; William E. Duellman; Marcel A. Caminer; Diana Pazmiño; William J. Etges Advertisement calls and DNA sequences reveal a new species of Scinax (Anura: Hylidae) on the Pacific lowlands of Ecuador, PLOS ONE, Volume 13 (2018) no. 9, p. e0203169 | DOI:10.1371/journal.pone.0203169
  • Jean-Pierre Vacher; Philippe J.R. Kok; Miguel T. Rodrigues; Jucivaldo Dias Lima; Andy Lorenzini; Quentin Martinez; Manon Fallet; Elodie A. Courtois; Michel Blanc; Philippe Gaucher; Maël Dewynter; Rawien Jairam; Paul Ouboter; Christophe Thébaud; Antoine Fouquet Cryptic diversity in Amazonian frogs: Integrative taxonomy of the genus Anomaloglossus (Amphibia: Anura: Aromobatidae) reveals a unique case of diversification within the Guiana Shield, Molecular Phylogenetics and Evolution, Volume 112 (2017), p. 158 | DOI:10.1016/j.ympev.2017.04.017
  • Marcel A. Caminer; Borja Milá; Martin Jansen; Antoine Fouquet; Pablo J. Venegas; Germán Chávez; Stephen C. Lougheed; Santiago R. Ron; Stefan Lötters Systematics of the Dendropsophus leucophyllatus species complex (Anura: Hylidae): Cryptic diversity and the description of two new species, PLOS ONE, Volume 12 (2017) no. 3, p. e0171785 | DOI:10.1371/journal.pone.0171785
  • Miquéias Ferrão; Olavo Colatreli; Rafael de Fraga; Igor L. Kaefer; Jiří Moravec; Albertina P. Lima; William J. Etges High Species Richness of Scinax Treefrogs (Hylidae) in a Threatened Amazonian Landscape Revealed by an Integrative Approach, PLOS ONE, Volume 11 (2016) no. 11, p. e0165679 | DOI:10.1371/journal.pone.0165679
  • Santiago R. Ron; Pablo J. Venegas; H. Mauricio Ortega-Andrade; Giussepe Gagliardi-Urrutia; Patricia E. Salerno Systematics of Ecnomiohyla tuberculosa with the description of a new species and comments on the taxonomy of Trachycephalus typhonius (Anura, Hylidae), ZooKeys, Volume 630 (2016), p. 115 | DOI:10.3897/zookeys.630.9298
  • Antoine Fouquet; Elodie A. Courtois; Daniel Baudain; Jucivaldo Dias Lima; Sergio Marques Souza; Brice P. Noonan; Miguel T. Rodrigues The trans-riverine genetic structure of 28 Amazonian frog species is dependent on life history, Journal of Tropical Ecology, Volume 31 (2015) no. 4, p. 361 | DOI:10.1017/s0266467415000206
  • Serena Zaccara; Giuseppe Crosa; Isabella Vanetti; Giorgio Binelli; David M. Harper; Kenneth M. Mavuti; John D. Balarin; J. Robert Britton Genetic and morphological analyses indicate high population mixing in the endangered cichlid Alcolapia flock of East Africa, Conservation Genetics, Volume 15 (2014) no. 2, p. 429 | DOI:10.1007/s10592-013-0551-2
  • Marcel Caminer; Santiago Ron Systematics of treefrogs of the Hypsiboas calcaratus and Hypsiboas fasciatus species complex (Anura, Hylidae) with the description of four new species, ZooKeys, Volume 370 (2014), p. 1 | DOI:10.3897/zookeys.370.6291
  • Julián Faivovich; Roy W. Mcdiarmid; Charles W. Myers Two New Species ofMyersiohyla(Anura: Hylidae) from Cerro De La Neblina, Venezuela, with Comments on Other Species of the Genus, American Museum Novitates, Volume 3792 (2013) no. 3792, p. 1 | DOI:10.1206/3792.1
  • Antoine Fouquet; Renato Recoder; Mauro Teixeira; José Cassimiro; Renata Cecília Amaro; Agustín Camacho; Roberta Damasceno; Ana Carolina Carnaval; Craig Moritz; Miguel Trefaut Rodrigues Molecular phylogeny and morphometric analyses reveal deep divergence between Amazonia and Atlantic Forest species of Dendrophryniscus, Molecular Phylogenetics and Evolution, Volume 62 (2012) no. 3, p. 826 | DOI:10.1016/j.ympev.2011.11.023
  • Santiago Ron; Pablo J. Venegas; Eduardo Toral; V. Morley Read; Diego Ortiz; Andrea Manzano Systematics of the Osteocephalus buckleyi species complex (Anura, Hylidae) from Ecuador and Peru, ZooKeys, Volume 229 (2012), p. 1 | DOI:10.3897/zookeys.229.3580
  • Antoine Fouquet; David M. Green; Bruce Waldman; Julia H. Bowsher; Katherine P. McBride; Neil J. Gemmell Phylogeography of Leiopelma hochstetteri reveals strong genetic structure and suggests new conservation priorities, Conservation Genetics, Volume 11 (2010) no. 3, p. 907 | DOI:10.1007/s10592-009-9935-8
  • Antoine Fouquet; André Gilles; Miguel Vences; Christian Marty; Michel Blanc; Neil J. Gemmell; Jean-Nicolas Volff Underestimation of Species Richness in Neotropical Frogs Revealed by mtDNA Analyses, PLoS ONE, Volume 2 (2007) no. 10, p. e1109 | DOI:10.1371/journal.pone.0001109

Cité par 22 documents. Sources : Crossref


Commentaires - Politique