Outline
Comptes Rendus

Medical sciences / Sciences médicales
Mutational spectrum of dihydropyrimidine dehydrogenase gene (DPYD) in the Tunisian population
Comptes Rendus. Biologies, Volume 330 (2007) no. 10, pp. 764-769

Abstracts

Dihydropyrimidine dehydrogenase enzyme (DPD) deficiency is a pharmacogenetic syndrome leading to severe side-effects in patients receiving therapies containing the anticancer drug 5-fluorouracil (5-FU). The aim of this population study is to evaluate gene variations in the coding region of the dihydropyrimidine dehydrogenase gene (DPYD) in the Tunisian population. One hundred and six unrelated healthy Tunisian volunteers were genotyped by denaturing HPLC (DHPLC). Twelve variants in the coding region of the DPYD were detected. Allele frequencies of DPYD*5 (A1627G), DPYD*6 (G2194A), DPYD*9A (T85C), A496G, and G1218A were 12.7%, 7.1%, 13.7%, 5.7%, and 0.5%, respectively. The DPYD alleles DPYD*2A (IVS 14+1g>1), DPYD*3 (1897 del C) and DPYD*4 (G1601A) associated with DPD deficiency were absent from the examined subjects. We describe for the first time a new intronic polymorphism IVS 6–29 g>t, found in an allelic frequency of 4.7% in the Tunisian population. Comparing our data with that obtained in Caucasian, Egyptian, Japanese and African–American populations, we found that the Tunisian population resembles Egyptian and Caucasian populations with regard to their allelic frequencies of DPYD polymorphisms. This study describes for the first time the spectrum of DPYD sequence variations in the Tunisian population.

Le déficit enzymatique en dihydropyrimidine déhydrogénase est un syndrome pharmacogénétique entraînant de sévères toxicités chez les patients cancéreux traités par le 5-fluorouracile (5-FU). L'objectif de notre étude est de déterminer les variations génétiques touchant le gène de la DPD (DPYD) chez la population tunisienne. L'ADN de 106 volontaires a été analysé par denaturing HPLC (DHPLC). Douze variations génétiques ont été observées dans la région codante de la DPYD. Les fréquences alléliques de DPYD*5 (A1627G), DPYD*6 (G2194A), DPYD*9A (T85C), A496G et G1218A étaient de 12,7%, 7,1%, 13,7%, 5,7% et 0,5 %, respectivement. Les allèles DPYD*2A (IVS 14+1g>1), DPYD*3 (1897 del C) et DPYD*4 (G1601A), causant des déficits en DPD, n'ont pas été observés. On a trouvé un nouveau polymorphisme intronique IVS 6–29 g>t, la fréquence allélique étant de 4,7%. Grâce à la comparaison des fréquences alléliques, on peut conclure que la population tunisienne ressemble à ses homologues égyptienne et caucasienne.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2007.08.003
Keywords: 5-Fluorouracile, Tunisian population, Dihydropyrimidine dehydrogenase gene, DHPLC
Mots-clés : 5-Fluorouracile, Population tunisienne, Gène de la dihydropyrimidine déhydrogenase, DHPLC

Radhia Ben Fredj  1 ; Eva Gross  2 ; Lotfi Chouchen  3 ; Fatma B'Chir  1 ; Slim Ben Ahmed  4 ; Steffi Neubauer  2 ; Marion Kiechle  2 ; Saâd Saguem  1

1 Metabolic Biophysics and Applied Pharmacology Laboratory, Department of Biophysics, Medicine Faculty of Sousse, 4002 Sousse, Tunisia
2 Department of Obstetrics and Gynecology, Technical University of Munich, Ismaninger Strasse 22, 81675 Munich, Germany
3 Molecular immuno-oncology Laboratory, Medicine Faculty of Monastir, 5019 Monastir, Tunisia
4 Department of oncology diseases, Central University Hospital ‘Farhat-Hached’ of Sousse, 4002 Sousse, Tunisia
Radhia Ben Fredj; Eva Gross; Lotfi Chouchen; Fatma B'Chir; Slim Ben Ahmed; Steffi Neubauer; Marion Kiechle; Saâd Saguem. Mutational spectrum of dihydropyrimidine dehydrogenase gene (DPYD) in the Tunisian population. Comptes Rendus. Biologies, Volume 330 (2007) no. 10, pp. 764-769. doi: 10.1016/j.crvi.2007.08.003
@article{CRBIOL_2007__330_10_764_0,
     author = {Radhia Ben Fredj and Eva Gross and Lotfi Chouchen and Fatma B'Chir and Slim Ben Ahmed and Steffi Neubauer and Marion Kiechle and Sa\^ad Saguem},
     title = {Mutational spectrum of dihydropyrimidine dehydrogenase gene {(DPYD)} in the {Tunisian} population},
     journal = {Comptes Rendus. Biologies},
     pages = {764--769},
     year = {2007},
     publisher = {Elsevier},
     volume = {330},
     number = {10},
     doi = {10.1016/j.crvi.2007.08.003},
     language = {en},
}
TY  - JOUR
AU  - Radhia Ben Fredj
AU  - Eva Gross
AU  - Lotfi Chouchen
AU  - Fatma B'Chir
AU  - Slim Ben Ahmed
AU  - Steffi Neubauer
AU  - Marion Kiechle
AU  - Saâd Saguem
TI  - Mutational spectrum of dihydropyrimidine dehydrogenase gene (DPYD) in the Tunisian population
JO  - Comptes Rendus. Biologies
PY  - 2007
SP  - 764
EP  - 769
VL  - 330
IS  - 10
PB  - Elsevier
DO  - 10.1016/j.crvi.2007.08.003
LA  - en
ID  - CRBIOL_2007__330_10_764_0
ER  - 
%0 Journal Article
%A Radhia Ben Fredj
%A Eva Gross
%A Lotfi Chouchen
%A Fatma B'Chir
%A Slim Ben Ahmed
%A Steffi Neubauer
%A Marion Kiechle
%A Saâd Saguem
%T Mutational spectrum of dihydropyrimidine dehydrogenase gene (DPYD) in the Tunisian population
%J Comptes Rendus. Biologies
%D 2007
%P 764-769
%V 330
%N 10
%I Elsevier
%R 10.1016/j.crvi.2007.08.003
%G en
%F CRBIOL_2007__330_10_764_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

The enzyme dihydropyrimidine dehydrogenase (DPD; EC 1.3.1.2) is a rate-limiting enzyme in the metabolic pathway involved in the breakdown of pyrimidine bases and the antineoplastic agent 5-fluorouracil [1–4]. As more than 80% of administered drug at standard dose are rapidly degraded by DPD to inactive compounds, the catabolic pathway of 5-FU plays a key role in drug response and 5-FU-induced toxicity [1–5].

A DPD-deficient phenotype manifesting as 5-FU-induced toxicity in cancer patients is at least in part due to inherited variations in the dihydropyrimidine dehydrogenase gene (DPYD) [4,6–10].

DPYD, located on chromosome 1p22, consists of 23 exons, spanning a genomic region of around 950 kb, and includes a 3-kb coding sequence with introns of average size of about 43 kb [11,12]. More than 39 different DPYD alleles have so far been identified. The DPYD*2A allele, due to a point mutation within the 5′-splice site of intron 14, results in the deletion of 55 amino acids and is the most frequent mutation in patients with partial or complete DPD deficiency [13,14]. In addition, a series of other mutations has been reported to be responsible for DPD protein alterations, leading to its reduced catalytic activity [13,15,16].

Among Caucasians populations, DPD activity is highly variable, influencing the individual response of cancer patients to fluoropyrimidine drugs, and has been shown to be related to DPYD gene sequence variations [17,18]. Few studies on the frequency of variant alleles of the DPYD gene in general populations have been performed. This study is one such contribution towards the DPYD gene database, reporting, for the first time, the frequency and type of sequence variations in the DPYD gene among the Tunisian population.

2 Materials and method

2.1 Study subjects

One hundred and six unrelated Tunisian subjects participated in this study; all subjects were of Arab origin. The individuals were of different ages (between 21 and 72 years) and consisted of 47 women and 59 men.

Genomic DNA was isolated from blood samples using the Wizard Genomic DNA purification kit (cat. #A1120) (Promega, Madison, USA) according to the instructions of the manufacturer.

2.2 PCR amplification of DPYD exons

Primer pairs utilised for the amplification of DPYD exons and exons–intron boundaries were as reported previously [19]. Amplicons were generated with the expand high-fidelity PCR system (Roche, Mannheim, Germany). The PCR reactions were performed in a volume of 50 μl with 33 cycles consisting of a denaturation step at 94 °C for 35 s, primer annealing for 30 s and an elongation step at 72 °C for 1 min, unless otherwise stated. The final step extension at 72 °C was performed during 5 min. Primer sequences and PCR conditions are listed in Table 1.

Table 1

Amplification and DHPLC conditions for DPYD mutation analysis

Exon Size (bp) 5′-Primer 3′-Primer PCR T° (°C) MgCl2 (mM) DHPLC T° (°C)
1 184 gctgtcacttggctctct cacctacccgcagagca 56 2 64.63
2 285 gtgacaaagtgagagagaccgtgtc gccttacaatgtgtggagtgagg 62 1.5 56.58
3 330 caattttaatgaatgctacccaat ctgaatggtggcaatgaact 55 2 56.58
4 245 ggtagaaaatagattatctc gatttgctaagacaagctg 50 2 53
5 284 gtttgtcgtaatttggctg atttgtgcatggtgatgg 52 1.5 53.58
6 357 gaggatgtaagctagtttc ccatttgtgtgcgtgaagttc 52 2 56
7 360 gtcctcatgcatatcttgtgtg gcttctgcctgcctgatgtagc 57 1.5 56
8 324 ttttggctgacttttcattc tggccaatcatttctatctg 53 2 54
9 242 ccctcctcctgctaatg gaacaatgtgctgctgag 54 2 55.57
10 342 gagagtgacacttcatcag ctgttggtgtacaactcc 51 1.5 60
11 442 actggtaaactcag caattccctgaaagctag 51 1.5 55.57
12 453 ttcctgtatgtgaggtgta gaagcacttatccattgg 51 1.5 55.57
13 440 cggatgactgtgttgaagtg tgtgtaatgataggtcgtgtc 56 1.5 52.58
14 410 tgcaaaaatgtgagaaggacc cagcaaagcaactggcagattc 60 1.5 54.58
15 358 tatctttgtgtacaactgga tgtgaaatccaaggacc 51 1.5 52
16 223 aacggtgaaagcctattgg tagtaactatccatacggggg 55 1.5 55.58
17 238 cacgtctccagctttgctgttg cgggcaactgattcaagtcaag 60 1.5 55.60
18 220 ttgaatgggttttaactatcgtgtctt aagaaagcacaatgcaag Touch down 60–50 1.5 55.60
19 300 tgtccagtgacgctgtcatcac cattgcatttgtgagatggag 56 1.5 55.58
20 399 gagaagtgacgctgtcatcac cacagacccatcatatggctg 52 1.5 58
21 228 tctgacctaacatgcttc ccagtaaagtaggcatac 51 2 56
22 291 gagcttgctaagtaattcagtggc agagcaatatgtggcacc 56 1.5 58
23 269 ggggacaatgatgatgacctatgtgg ggtgacatgaaagttcacagcac 55 2 59

2.3 Mutations analysis of the DPYD gene by DHPLC

DHPLC analysis was carried out using a semi-automated WAVE® DNA Fragment Analysis System equipped with a DNASep™ column (Transgenomic, Inc., Omaha, NE). The mutation analysis was performed under partially denaturing conditions to separate heteroduplex molecules in the case of heterozygous samples, as described previously [19]. Optimal heteroduplex recognition on the DNASep™ column occurs at a critical temperature that was predicted for each exon by melt software available either through the website http://insertion.stanford.edu/cgi-bin/melt.pl [20] or by the WaveMaker calculation software. In order to avoid missing any mutation, additional runs were carried out at one degree below and above the calculated temperature(s). Homozygous sequence alterations were detected by adding a known wild-type PCR sample to an unknown sample before heteroduplex generation. The peak profiles were compared to those of control samples possessing a known validated variation. DHPLC running conditions for each amplicon are summarized in Table 1. Samples exhibiting atypical profiles were further subjected to sequence analysis.

2.4 DNA sequencing

Identification of DNA variations was achieved by sequencing the respective PCR products using an Applied Biosystem model 310 DNA sequencing system.

2.5 Statistical analysis

Differences in allele frequencies between Tunisian and other ethnic populations were measured by the Fisher exact test. A P value below 0.05 was considered statistically significant throughout the population comparisons.

3 Results

A high-throughput mutation analysis of the coding region and the flanking intronic regions of the DPYD gene were performed by DHPLC. Twelve different variant alleles were found in 106 healthy Tunisian volunteers (212 chromosomes). Eighty-six alleles were identical with the reference sequence and were assigned as wild type and 126 alleles revealed sequence variations.

Many of the sequence variations were found clustered in exons 2, 6, 11, 13, 14 and 18 with allelic frequencies between 0.5% and 13.7% attesting the co-presence of rare variants and common polymorphisms. The DPYD variations identified by multiple peaks in the DHPLC chromatograms are listed in Table 2. Two subjects displayed G1236A nucleotide substitution corresponding to a silent E412E change. Another T1896C substitution, again a silent F632F change, was detected at an allelic frequency of 2.4%. A total of 82 alleles found in heterozygous state corresponded to non-synonymous amino acid substitutions. One among them was also found in homozygous state in a single subject and concerned the DPYD*9A allele (85T>C, C29R). Since this allele was found in heterozygous state in 27 subjects, it can be considered a common polymorphism in the Tunisian population. Interestingly, a DHPLC profile distinct from that of the wild type was found in intron 6 in 10 subjects. Sequence analysis revealed a novel intronic variation IVS 6–29 g>t at an allelic frequency of 4.7%, which is not uncommon in the studied Tunisian population.

Table 2

DPYD mutations in the Tunisian population

Exon Mutation Allele Effect Heterozygotes/106 subjects Homozygotes/106 subjects Allelic frequency (%)
2 T85C 9A C29R 27 1 13.7
6 A496G M166V 12 0 5.7
7 IVS 6–29g>t 10 0 4.7
8 IVS 8+113c>t 1 0 0.5
11 G1218A M406T 1 0 0.5
IVS 10–15 t>c 9 0 4.2
G1236A E412E 2 0 0.9
12 IVS 11–119 a>g 14 0 6.6
IVS 11–106 t>a 1 0 0.5
13 A1627G 5 I543V 27 0 12.7
14 T1896C F632F 5 0 2.4
18 G2194A 6 V732I 15 0 7.1

New intronic variation.

4 Discussion

Recent studies investigating the molecular mechanisms of DPD deficiency have indicated that genetic alterations in DPYD, including exon skipping [21], deletion [22], and missense mutations [14,23,24] may contribute to the DPD-deficient phenotype. The analysis of genetic variations of drug-metabolizing enzymes is thought to be a useful tool in predicting individuals being at risk for adverse drug reactions [25]. The enzyme DPD plays a critical role in the catabolism of the anticancer agent 5-FU and is involved in severe life-threatening reactions towards 5-FU in the case of DPD-deficient patients. The present study is the first report on the spectrum of DPYD variants in the Tunisian population.

Given the fact that DPYD locus is quite large and complex in terms of distribution of sequence variations over the gene stretch, we employed a high-throughput method for rapid identification of both known and unknown sequence variations in this gene [26,27].

Multiple heterozygous sequence variations in heterozygous state were detected in the studied Tunisian population, with allelic frequencies comparable to those of other populations, except for the DPYD*2A variant (Table 3). This deficient variant allele was not found in our cohort, contrary to the case of the Finnish [12] and Caucasian populations [13,14], who had allele frequencies of 0.9% and 1.1%, respectively. This could be due to the size of the cohort studied here.

Table 3

DPYD allele frequency in different populations

Frequency of DPYD variants (P value vs. Tunisian)
Population (réf) n *2 A(a) *3 (b) *4 *5 *6 *9A A496G G1218A
Tunisian (this study) 212 0 0 0 0.126 0.072 0.128 0.057 0.006
Caucasian (18) 314 0 0 0.016 NS 0.14 NS 0.002 (<0.0001) 0.19 (0.05) 0.08 NS 0.01 NS
Finish (12) 180 0.011 0.033 (0.02) 0.072 NS 0.067 NS
British (3) 120 0 0 0.008 NS 0.28 (0.0004) 0.058 NS
Egyptian (17) 478 0 0 0.028 (0.03) 0.115 NS 0.09 NS
Japanese (12) 100 0 0.011 0.35 (<0.0001) 0.044 NS
Taiwanese (12) 262 0 0 0.21 (0.01) 0.014 NS
African–American (12) 210 0 0.005 0.227(0.009) 0.019 (0.01)

The DPYD*5 allele, not associated with DPD deficiency, was observed in Tunisian samples with an allele frequency of 12.7%, similar to that found in Egyptians [17] and Caucasians [18], with a frequency of 11.5% and 14%, respectively, but at a lower frequency than in Japanese (35%), Taiwanese (21%), and African–Americans (22.7%) [12,28]. The second most common polymorphism in the Tunisian population was DPYD*9A, at a frequency of 13.7%.

For DPYD*6, a non-deficient allele, the observed frequency in our population was 7.1% and was comparable to that of Caucasians, Japanese, Africans, Finnish, and Egyptians (5%, 9.8%, 4%, 6.7%, and 9%, respectively), with the lowest frequency for the Taiwanese people (1.4%) [12,29].

The variant A496G (Met166Val) allele [4,19,30] was found at a frequency of 5.7% in our population, and the impact of amino acid change on DPD function is controversial: it is reported as associated with reduced DPD activity [30,31] as well described as an allele with normal DPD enzyme activity [32].

Some of the detected point mutations are common in all populations, but exhibited some population differences in their frequency.

However, functionally relevant frequencies are rare in populations, and this is the case with the studied Tunisian population.

In this study, we describe, for the first time, a new intronic polymorphism found with allelic frequencies of 4.8% in the Tunisian population, IVS 6–29 g>t (intron 6). Since this variation was not observed in 157 Caucasian individuals [18], we may consider it as ‘restricted’ to the Tunisian population and maybe to neighbouring population groups.

Acknowledgements

We are grateful to voluntary blood donors who provided us with samples for this study.


References

[1] F.J. Gonzalez; P. Fernandez-Salguero Diagnostic analysis, clinical importance and molecular basis of dihydropyrimidine dehydrogenase deficiency, Trends Pharmacol. Sci., Volume 16 (1995), pp. 325-327

[2] J.L. Grem 5-Fluoropyrimidines (B.A. Chabner; D.L. Long, eds.), Cancer Chemotherapy and Biotherapy, Lippincott-Raven, Philadelphia, 1996, pp. 149-197

[3] K. Omura Clinical implications of dihydropyrimidine dehydrogenase (DPD) activity in 5-FU-based chemotherapy mutations in the DPD gene, and DPD inhibitory fluoropyrimidines, Int. J. Clin. Oncol., Volume 8 (2003), pp. 132-138

[4] A.B.P. Van Kuilenburg; J. Haasjes; D.J. Richel; L. Zoetekouw; H. Van Lenthe; R.A. De Abrau; J.G. Maring; P. Vreken; A.H. Van Gennip Clinical implication of dihydropyrimidine dehydrogenase (DPD) deficiency in patients with severe 5-fluorouracil-associated toxicity: identification of new mutation in the DPD gene, Clin. Cancer Res., Volume 6 (2000), pp. 4705-4712

[5] G.D. Heggie; J.P. Sommadossi; D.S. Cross; W.J. Huster; R.B. Diasio Clinical pharmacokinetic of 5-fluorouracil and its metabolites in plasma, urine and bile, Cancer Res., Volume 47 (1987), pp. 2203-2206

[6] E.S.K. Collie-Duguid; M.C. Etienne; G. Milano; H.L. Mc Leod Known variant DPYD alleles do not explain DPD deficiency in cancer patients, Pharmacogenetics, Volume 10 (2000), pp. 17-223

[7] M.R. Johnson; A. Hageboutros; K.L. Wang; L. High; J.B. Smith; R.B. Diasio Life threatening toxicity in a dihydropyrimidine dehydrogenase deficient patient after treatment with topical 5-Fluorouracil, Clin. Cancer Res., Volume 5 (1999), pp. 2006-2011

[8] M. Kouwaki; N. Hamajima; S. Sumi; M. Nonaka; M. Sasaki; K. Dobashi; K.H. Kiduchi; Y. Togari; Y. Wada Identification of novel mutations in the dihydropyrimidine dehydrogenase gene in a Japanese patient with 5-fluorouracil toxicity, Clin. Cancer Res., Volume 4 (1998), pp. 2999-3004

[9] A.B.P. Van Kuilenburg; P. Vreken; L.V.A.M. Beex; R. Meinsma; H. Van Lenthe; R.A. De Abrau; A.H. Van Gennip Heterozygosity for a point mutation in an invariant splice donor site of dihydropyrimidine dehydrogenase and severe 5-fluorouracil-related toxicity, Eur. J. Cancer, Volume 33 (1997), pp. 2258-2264

[10] X. Wei; H.L. McLeod; M.C. Murrough; F.J. Gonzalez; P.F. Salguero Molecular basis of the human dihydropyrimidine dehydropyrimidine deficiency and 5-fluorouracil toxicity, J. Clin. Invest., Volume 3 (1996), pp. 610-615

[11] S. Takai; P. Fernandez-Salguero; S. Kimura; F.G. Gonzalez; K. Yamada Assignment of the human dihydropyrimidine dehydrogenase (DPYD) to chromosome region 1p22 by fluorescence in situ hybridation, Genomics, Volume 24 (1994), pp. 613-614

[12] X. Wei; G. Elizondo; A. Sapone; H.L. Mc Leod; H. Raunio; P. Fernandez-Salguero; F.J. Gonzalez Characterization of the human dihydropyrimidine dehydrogenase gene, Genomics, Volume 51 (1998), pp. 391-400

[13] M. Raida; W. Schwabe; P. Hausler; A.B.P. Van Kuilenburg; A.H. Van Gennip; D. Behnke; K. Höffken Prevalence of a common point mutation in the dihydropyrimidine dehydrogenase (DPD) gene within the 5′-splice donor site of intron 14 in patients with severe 5-fluorouracil (5-FU)-related toxicity compared with controls, Clin. Cancer Res., Volume 7 (2001), pp. 2832-2839

[14] A.B.P. Van Kuilenburg; P. Vreken; N.G.G.M. Abeling; H.D. Bakker; R. Meinsma; H. Van Lenthe; R.A. De Abreu; J.A.M. Smeitink; H. Kayserili; M.Y. Apak; E. Christensen; I. Holopainen; K. Pulkki; D. Riva; G. Botteon; E. Holme; M. Tulinius; W.J. Kleijer; F.A. Beemer; M. Duran; K.E. Niezen-Koning; G.P.A. Smit; C. Jakobs; L.M.E. Smit; U. Moog; L.J.M. Spaapen; A.H. Van Gennip Genotype and phenotype in patients with dihydropyrimidine dehydrogenase deficiency, Hum. Genet., Volume 104 (1999), pp. 1-9

[15] P. Fernanduez-Sanguero; A. Sapone; X. Wei; J.R. Holt; S. Jones; J.R. Idle; F.J.L. Gonzalez Lack of correlation between phenotype and genotype for polymorphically expressed dihydropyrimidine dehydrogenase in a family of Pakistani origin, Pharmacogenetics, Volume 7 (1997), pp. 161-163

[16] A.B.P. Van Kuilenburg; E.W. Muller; J. Haasjes; R. Meinsma; L. Zoetekouw; H.R. Waterham; F. Baas; D.J. Richel; A.H. Van Gennip Lethal outcome of a patient with a complete dihydropyrimidine dehydrogenase (DPD) deficiency after administration of 5-fluorouracil: frequency of the common IVS 14+1GA mutation causing DPD deficiency, Clin. Cancer Res., Volume 7 (2001), pp. 1149-1153

[17] S.I. Hamdy; M. Hiratsuka; K. Narahara; M. El-Enany; N. Moursi; M.S.E. Ahmed; M. Mizugaki Allele and genotype frequencies of polymorphic cytochromes P450 (CYP2C9, CYP2C19, CYP2E1) and dihydropyrimidine dehydrogenase (DPYD) in the Egyptian population, Br. J. Clin. Pharmacol., Volume 6 (2002), pp. 596-603

[18] K. Seck; S. Riemer; R. Kates; T. Ullrich; V. Lutz; N. Harbeck; M. Schmitt; M. Kiechle; R.B. Diasio; E. Gross Analysis of the DPYD gene implicated in 5-fluorouracil catabolism in a cohort of Caucasian individuals, Clin. Cancer Res., Volume 11 (2005), pp. 5886-5892

[19] E. Gross; K. Seck; S. Neubauer; J. Mayr; H. Hellebrand; A. Ratanaphan; V. Lutz; H. Stockinger; M. Kiechle High-throughput genotyping by DHPLC of the dihydropyrimidine dehydrogenase gene implicated in (fluoro) pyrimidine catabolism, Int. J. Oncol., Volume 22 (2003), pp. 325-332

[20] A.C. Jones; J. Austin; N. Hansen; B. Hoogendoorn; P. Oefner; J.P. Cheadle; M.C. O'Donovan Optimal temperature selection for mutation detection by denaturing HPLC and comparison to single-stranded conformation polymorphism and heteroduplex analysis, Clin. Chem., Volume 45 (1999), pp. 1133-1140

[21] R. Meinsma; P. Fernandez-Salguero; A.B.P. Van Kuilenburg; A.H. Van Gennip; F.J. Gonzalez Human polymorphism in drug metabolism: mutation in the dihydropyrimidine dehydrogenase gene results in exon skipping and thymine Uracilurea, DNA Cell Biol., Volume 14 (1995), pp. 1-6

[22] P. Vreken; A.B.P. Van Kuilenburg; R. Meinsma; R.A. De Abreu; A.H. Van Gennip; A.B.P. Van Kuilenburg Identification of a four-base deletion (del TCAT296–299) in the dihydropyrimidine dehydrogenase gene with variable clinical expression, Hum. Genet., Volume 100 (1997), pp. 263-265

[23] A.B.P. Van Kuilenburg; P. Vreken; D. Riva; G. Botteon; N.G.G.M. Abeling; H.D. Bakker Clinical and biochemical abnormalities in a patient with dihydropyrimidine dehydrogenase deficiency due to homozygosity for the C29R mutation, J. Inherit. Metab. Dis., Volume 22 (1999), pp. 191-192

[24] P. Vreken; A.B.P. Van Kuilenburg; R. Meinsma; A.H. Van Gennip Dihydropyrimidine dehydrogenase (DPD) deficiency: identification and expression of missense mutations C29R, R886H and R235W, Hum. Genet., Volume 101 (1997), pp. 333-338

[25] W.E. Evans; H.L. McLeod Pharmacogenomics-drug disposition, drug targets, and side effects, N. Engl. J. Med., Volume 348 (2003), pp. 538-549

[26] H. Ezzeldin; Y. Okamoto; M.R. Johnson; R.B. Diasio A high-throughput denaturing high-performance liquid chromatographymethod for the identification of variant alleles associated with dihydropyrimidine dehydrogenase deficiency, Anal. Biochem., Volume 306 (2002), pp. 63-73

[27] H. Ezzeldin; M.R. Johnson; Y. Okamoto; R.B. Diasio Denaturing high-performance chromatography analysis of the DPYD gene in patients with lethal 5-fluorouracil toxicity, Clin. Cancer Res., Volume 9 (2003), pp. 3021-3028

[28] R. Ahluwalia; R. Freimuth; L.H. McLeod; S. Marsh Use of pyrosequencing to detect clinically relevant polymorphisms in dihydropyrimidine dehydrogenase, Clin. Chem., Volume 49 (2003), pp. 1661-1664

[29] S.A. Ridge; J. Sludden; O. Brown; L. Robertson; X. Wei; A. Sapone; P.M. Fernandez-Salguero; F.J. Gonzalez; P. Vreken; A.B.P. Van Kuilenburg; A.H. Van Gennip; H.L. McLeod Dihydropyrimidine dehydrogenase pharmacogenetics in Caucasian subjects, Br. J. Clin. Pharmacol., Volume 46 (1998), pp. 151-156

[30] E. Gross; T. Ullrich; K. Seck; V. Mueller; M. de Wit; C. Von Schlling; A. Meindl; M. Schmitt; M. Kiechle Detailed analysis of five mutations in dihydropyrimidine dehydrogenase detected in cancer patients with 5-fluorouracil-related side effects, Hum. Mutat., Volume 22 (2003), p. 498

[31] H.J. Cho; Y.S. Park; W.K. Kang; J.W. Kim; S.Y. Lee Thymidylate synthase (TYMS) and dihydropyrimidine dehydrogenase (DPYD) polymorphisms in the Korean population for prediction of 5-fluorouracil-associated toxicity, Ther. Drug Monit., Volume 29 (2007) no. 2, pp. 190-196

[32] M.R. Johnson; K. Wang; R.B. Diasio Profound dihydropyrimidine dehydrogenase (DPD) deficiency resulting from a novel compound heterozygote genotype, Clin. Cancer Res., Volume 8 (2002), pp. 768-774


Comments - Policy