Outline
Comptes Rendus

Molecular biology and genetics/Biologie et génétique moléculaires
Development of Exon-Primed Intron-Crossing (EPIC) PCR primers for the malaria vector Anopheles pseudopunctipennis (Diptera: Culicidae)
Comptes Rendus. Biologies, Volume 335 (2012) no. 6, pp. 398-405

Abstracts

Using the Anopheles gambiae Giles genome as a template, we designed, screened and identified 14 novel Exon-Primed Intron-Crossing (EPIC) PCR primer pairs for Anopheles pseudopunctipennis Theobald 1901, a major vector of human Plasmodium sp. in South America. These primers were designed to target the conserved regions flanking consecutive exons of different genes and enabled the amplification of 17 loci of which nine were polymorphic. Polymorphisms at these loci ranged from two to four alleles. Intron length polymorphism analysis is a useful tool, which will allow the study of the population structure of this mosquito species, which remains poorly understood.

Utilisant le génome d’Anopheles gambiae Giles comme modèle, nous avons identifié 14 nouvelles Exon-Primed Intron-Crossing (EPIC) paires d’amorces PCR pour Anopheles pseudopunctipennis Theobald 1901, un vecteur majeur de Plasmodium sp. humains en Amérique du Sud. Ces amorces ont été conçues afin de cibler les régions conservées flanquant les exons consécutifs de différents gènes et ont permis l’amplification de 17 loci dont neuf étaient polymorphes. Le polymorphisme de ces loci varie de deux à quatre allèles. L’analyse du polymorphisme de longueur d’intron est un outil utile qui permettra l’étude de la structure de la population de cette espèce de moustique, qui demeure mal comprise.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2012.05.002
Keywords: EPIC-PCR, Anopheles pseudopunctipennis, Malaria, Primer, Intron
Mots-clés : EPIC-PCR, Anopheles pseudopunctipennis, Paludisme, Amorce, Intron

Frédéric Lardeux  1 , 2 ; Claudia Aliaga  1 , 2 ; Rosenka Tejerina  1 , 2 ; Raùl Ursic-Bedoya  3

1 Institut de recherche pour le développement (IRD), C.P. 9214 La Paz, Bolivia
2 Instituto Nacional de Laboratorios de Salud (INLASA), Laboratorio de Entomologia Medica, Rafael Zubieta no 1889, Casilla M-10019, Miraflores, La Paz, Bolivia
3 Simon Fraser University, Department of Biological Sciences, 8888 University Dr., Burnaby, BC V5A1S6, Canada
Frédéric Lardeux; Claudia Aliaga; Rosenka Tejerina; Raùl Ursic-Bedoya. Development of Exon-Primed Intron-Crossing (EPIC) PCR primers for the malaria vector Anopheles pseudopunctipennis (Diptera: Culicidae). Comptes Rendus. Biologies, Volume 335 (2012) no. 6, pp. 398-405. doi: 10.1016/j.crvi.2012.05.002
@article{CRBIOL_2012__335_6_398_0,
     author = {Fr\'ed\'eric Lardeux and Claudia Aliaga and Rosenka Tejerina and Ra\`ul Ursic-Bedoya},
     title = {Development of {Exon-Primed} {Intron-Crossing} {(EPIC)} {PCR} primers for the malaria vector {\protect\emph{Anopheles} pseudopunctipennis} {(Diptera:} {Culicidae)}},
     journal = {Comptes Rendus. Biologies},
     pages = {398--405},
     year = {2012},
     publisher = {Elsevier},
     volume = {335},
     number = {6},
     doi = {10.1016/j.crvi.2012.05.002},
     language = {en},
}
TY  - JOUR
AU  - Frédéric Lardeux
AU  - Claudia Aliaga
AU  - Rosenka Tejerina
AU  - Raùl Ursic-Bedoya
TI  - Development of Exon-Primed Intron-Crossing (EPIC) PCR primers for the malaria vector Anopheles pseudopunctipennis (Diptera: Culicidae)
JO  - Comptes Rendus. Biologies
PY  - 2012
SP  - 398
EP  - 405
VL  - 335
IS  - 6
PB  - Elsevier
DO  - 10.1016/j.crvi.2012.05.002
LA  - en
ID  - CRBIOL_2012__335_6_398_0
ER  - 
%0 Journal Article
%A Frédéric Lardeux
%A Claudia Aliaga
%A Rosenka Tejerina
%A Raùl Ursic-Bedoya
%T Development of Exon-Primed Intron-Crossing (EPIC) PCR primers for the malaria vector Anopheles pseudopunctipennis (Diptera: Culicidae)
%J Comptes Rendus. Biologies
%D 2012
%P 398-405
%V 335
%N 6
%I Elsevier
%R 10.1016/j.crvi.2012.05.002
%G en
%F CRBIOL_2012__335_6_398_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

The mosquito Anopheles pseudopunctipennis Theobald 1901 (Diptera: Culicidae) is a major vector of human Plasmodium sp. in South America. It is a difficult species to characterize as demonstrated by its variable behavior, habits and ecological needs [1], its inconsistencies as a malaria vector in its wide distribution range [2] and the several morphological subspecies described [3]. Crossmating experiments and cytogenetic studies pointed out evidence that these mosquitoes are comprised of a species complex [4,5]. Although the genetic variability and population structure of An. pseudopunctipennis has been studied biochemically, many aspects remain poorly known [6]. This species lacks specific molecular tools, and because of its high level of variability, more data are urgently needed to better understand how the population genetic structure of this mosquito is related to malaria transmission. Such data will help to better target vector control strategies by Public Health authorities.

Variability of non-coding sequences, particularly intron sequences, is a valuable marker of population variation and subdivision, and can be assayed by PCR amplification using conserved exon primers. Intron-targeted PCR was pioneered by Lessa [7]. This approach, called Exon-Primed Intron-Crossing (EPIC)-PCR [8,9], has been shown to identify substantial variability, mainly from intron length polymorphism. Introns constitute suitable markers for analyzing population structure within a species [10–15] as well as for reconstructing relationships among closely related species [16–18]. EPIC have been also used in gene mapping [19–23], and phylogeography [24–28] where they are the most widely used nuclear markers for such studies [29]. EPIC-PCR has several advantages in populations genetic studies:

  • • by using primers from heterologous genes, cloning and sequencing steps can be avoided [30,31];
  • • cross-species amplification is easier than when primers are designed from highly conserved exon sequences;
  • • for the same reason, within species, PCR artefacts such as null alleles are expected to be less frequent.

Further advantages are that intron systems do not require previous knowledge of the genome to be analyzed; they are generally polymorphic and sometimes hypervariable; are expected to be codominant and selectively neutral; are easily amplifiable by PCR; can be revealed on simple agarose or acrylamide gels; and can be obtained at low cost [32]. Moreover, having both the exon and intron fragments, EPIC can be useful for examining genetic variation at the intraspecific and interspecific level simultaneously, a feature that is particularly useful when studying species complexes [27]. EPIC markers are becoming more popular for use in population genetic studies in insects [13–15,33,34] and do not require assumptions about a particular model of evolution that is often required for microsatellites [14]. In the present article, primers for EPIC amplification of intron sequences for An. pseudopunctipennis are designed, of which several pairs amplify (length)-polymorphic loci that can be used in population genetic studies of this malaria vector.

2 Materials and methods

2.1 Mosquitoes

In October 2006, females An. pseudopunctipennis were captured by one of us (F.L.) from a natural population in Mataral (S 18.6024, W 65.1444, altitude 1500 m), a small village situated in the dry inter-Andean valleys in the centre of Bolivia, using the human bait collection technique outside houses. In the field, collected insects were chloroform killed and stored over desiccant (silica gel) in small vials. In the laboratory, mosquitoes were identified using [35] and kept at –20 °C in their individual vials with silica gel until DNA extraction.

For the various EPIC-PCR (see paragraph below), positive controls consisted in females An. gambiae from a laboratory strain and were provided by our main laboratory at IRD-Montpellier (France). These mosquitoes were stored using the same conditions as for An. pseudopunctipennis until processing.

2.2 Selection of introns and design of primers

Primers for An. pseudopunctipennis were designed from the conserved regions of consecutive exons of different genes from the closely related species Anopheles gambiae Giles. Exon sequences were downloaded in 2005 at http://www.anobase.com in Excel format from the An. gambiae genome database. Gene candidates that were dispersed amongst the An. gambiae genome were selected, and close genes on the same chromosome were avoided. Gene candidates with a higher percentage of similarity with genes from Diptera Apis mellifera and Drosophila melanogaster, were first selected to enhance the chance of similarity to genes from An. pseudopucntipennis.

Intron lengths ranged from 100 to 500 bp. Primers pairs were designed to target the flanking exon sequences taking into account their stability (in terms of CG content and ending with CG or GC), their size (18–20 pb), their close annealing temperatures, and the low probability of primer-dimer formation during the PCR. Possible primers adjacent to the intron sequences were discarded. Fifty-four primer pairs were initially designed and screened by PCR using An. pseudopunctipennis DNA as a template (Table 1).

Table 1

The fifty-four selected genes and their accession number.

Primer pair no Gene Accession number Primer pair no Gene Accession number
1 AgaP_AGAP005839 XM_315863.4 28 AgaP_AGAP011438 XM_554781
2 AgaP_AGAP003128 XM_001237495.2 29 AgaP_AGAP011717 XM_320795.4
3 AgaP AGAP012571 XM_307301.3 30 AgaP_AGAP010343 XM_311599.4
4 AgaP_AGAP011936 XM_320597.4 31 AgaP_AGAP010725 XM_559235.3
5 AgaP_AGAP001573 XM_551238.3 32 AgaP_AGAP001813 XM_321242.4
6 AgaP_AGAP008026 XM_555438.3 33 AgaP_AGAP003857 XM_310416.6
7 AgaP_AGAP004780 XM_318036.4 34 AgaP_AGAP004298 XM_313573.4
8 AgaP_AGAP005961 XM_316001.4 35 AgaP_AGAP002956 XM_311943.3
9 AgaP AGAP012014 XM_320516.2 36 AgaP_AGAP002301 XM_312670.1
10 AgaP AGAP011363 XM_001238009.2 37 AgaP_AGAP003360 XM_314262.4
11 AgaP_AGAP011166 XM_309483.4 38 AgaP_AGAP001407 XM_321726.4
12 AgaP_AGAP001874 XM_550942.3 39 AgaP_AGAP003437 XM_311723.4
13 AgaP_AGAP007887 XM_317605.4 40 AgaP AGAP007738 XM_001689008.1
14 AgaP_AGAP009824 XM_318932.3 41 AgaP AGAP008288 XM_001688954.1
15 AgaP_AGAP004745 XM_318073 42 AgaP AGAP009200 XM_319976.3
16 AgaP_AGAP004934 XM_315024.3 43 AgaP_AGAP008938 XM_319692.3
17 AgaP_AGAP005622 XM_315632.3 44 AgaP_AGAP009835 XM_553715.3
18 AgaP_AGAP005693 XM_315704.4 45 AgaP_AGAP009785 XM_318880.4
19 AgaP_AGAP005806 XM_315822.4 46 AgaP_AGAP009856 XM_318967.4
20 AgaP AGAP006809 XM_308938.4 47 AgaP_AGAP004698 XM_318145.4
21 AgaP_AGAP006825 XM_308919.3 48 AgaP_AGAP004775 XM_318039.4
22 AgaP_AGAP007640 XM_308229.4 49 AgaP_AGAP004841 XM_314353.3
23 AgaP_AGAP007720 XM_574504.3 50 AgaP_AGAP004717 XM_318113.4
24 AgaP_AGAP008526 XM_316916.3 51 AgaP_AGAP004862 XM_314327.3
25 AgaP_AGAP008527 XM_316915.4 52 AgaP_AGAP004915 XM_315006.4
26 AgaP_AGAP012345 XM_320207.4 53 AgaP_AGAP004692 XM_001231109.2
27 AgaP_AGAP011730 XM_320779.3 54 AgaP_AGAP005948 XM_315983.4

2.3 DNA extraction and amplification

An. pseudopunctipennis and An. gambiae DNA extractions were carried out on mosquito legs using a slightly modified cetyltrimethylammonium bromide (CTAB)-based protocol from Edwards [36]. The protocol was as followed: mosquito legs were homogenized in 200 μl lysis CTAB solution (100 mmol/l Tris HCl pH 8.0; 10 mmol/l EDTA pH 8.0; 1.4 mol/l NaCl and CTAB 2%) in 1.5 ml Eppendorf microcentrifuge tubes. Incubation was carried out at 65 °C for 15 min; the resulting extract was washed with 200 μl chloroform and centrifugated for 5 min at 12 000 rpm. The supernatant was precipitated in 200 μl isopropanol and centrifugated again at 12 000 rpm for 15 min. The pellet was washed with 200 μl 70% ethanol, centrifugated at 12 000 rpm for 5 min, dried at 37 °C for one hour and suspended in 100 μl nuclease-free H2O.

DNA amplifications were carried out immediately after extraction in volumes of 25 μl (1 × Taq buffer, 2.5 mM MgCl2, 0.4 mM dNTPs (Eurogentec, Angers, France), 0.5 UI Taq polymerase (Quiagen, Courtaboeuf, France), 20–25 ng of DNA template, and depending of the locus 0.04 μM or 0.4 μM of each primer (Eurogentec, Angers, France) (Table 2). The optimum annealing temperatures for each primer pair are listed in Table 2. PCR were performed on a Perkin Elmer DNA Thermal Cycler 480 (US Instrument Division, Norwalk, CT, USA) and conditions were: 1 min at 94 °C, followed by 36 cycles of 30 s at 94 °C, 30 s at annealing temperature, 30 s at 72 °C, and a final extension step of 5 min at 72 °C. The amplified products were first visualized on 1.5% agarose gels con ethidium bromide (Fig. 1). Then, for allele size analysis, they were separated by electrophoresis on 8% polyacrylamide gels and visualized by silver-staining. In all PCR, negative control (H2O) and positive controls (An. gambiae) were used.

Table 2

Sequences of the 14 pairs of primers which successfully amplified 17 loci from Anopheles pseudopunctipennis and their characterization.

Primer pair no Intron name Chromosome Accession number Primer sequences (5′–3′) Tm (°C) No. of alleles Sizes of alleles
(bp)
Amplification conditions No. mosquitoes H E H O Fis
1 G2LEX1236-1 2L XM_315863.4 F: TGGCTGGCTTCACGTCCG
R: CGAGTGCAGGAACGGTGA
55 4 114, 151, 165, 180 MM1 18 0.4 0.3 0.25
1 G2LEX1236-2 2L XM_315863.4 F: TGGCTGGCTTCACGTCCG
R: CGAGTGCAGGAACGGTGA
55 1 297 MM1 18
2 GUKEX1858 2R XM_001237495.2 F: GCCTGTGATCGTGCGTTTCG
R:GGCATACCAGCAGCGTGACG
55 4 794, 857, 870, 876 MM1 18 0.3 0.3 0.09
3 GUKEX1859-1 UNKN XM_307301.3 F: CGAGGAGGGTGTACAAACGC
R: GGTGTCGCCTAGCTCGCCCG
55 2 715, 766 MM1 20 0.5 0.7 –0.3
3 GUKEX1859-2 UNKN XM_307301.3 F:CGAGGAGGGTGTACAAACGC
R:GGTGTCGCCTAGCTCGCCCG
55 2 306, 320 MM1 20 0.1 0.1 0.65
3 GUKEX1859-3 UNKN XM_307301.3 F: CGAGGAGGGTGTACAAACGC
R: GGTGTCGCCTAGCTCGCCCG
55 3 183, 193, 197 MM1 20 0.2 0.1 0.79
4 G3LEX28 3L XM_320597.4 F:CCAACTACTCGGCCGTGC
R:GCCGGCCATCTCCTTCGC
60 3 246, 253, 261 MM2 18 0.4 0.4 0.02
5 G2REX47 2R XM_551238.3 F: GGCACGGTGGGGAAGACG
R: CCGTCCACCACCATCGGG
60 4 220, 228, 257, 273 MM2 18 0.3 0.4 –0.1
6 G3REX1037 3R XM_555438.3 F: GCAAACGCGAAAGAACCG
R: GCCTGGTAGCGCTTCTCG
60 4 281, 315, 345, 405 MM2 12 0.5 0 1
7 EX113 2L XM_318036.4 F: CATCTATCTGCTGAACTCGC
R: CGTCGGTCACATTCCACATC
60 3 541, 557, 574 MM2 14 0.4 0 1
8 EX1358 2L XM_31600104 F: CATGCCTCCAATGGTGCC
R: CCGTACGTTCCTTCGCCA
60 1 249 MM2 20
9 G3LEX3 3L XM_320516.2 F: CCGAAGATGAGCTCAGAGATGC
R: CCTAGCTTGTCGGTGATTTCTG
55 1 185 MM1 20
10 G3LEX9 3L XM_001238009.2 F: CGCCCTGCCTGGCATGGATTCG
R: GCAGGCACAGCCACCTTCCGGG
55 1 656 MM1 20
11 G3LEX36 3L XM_309483.4 F: CGCGGCAATCATGAGTGCGCC
R: CCACCGGCAGACAGTTGAAGC
55 1 191 MM1 20
12 G2REX46 2R XM_550942.3 F: CCGACGATAGAGGACAGC
R: GTTGAAGGTCGACTGTGC
60 1 497 MM2 20
13 G3REX491 3R XM_317605.4 F: CGTTGGAGCAGCAACAACAGC
R: GGTAATGATTCCTGATATTGC
55 1 136 MM2 20
14 G3REX1062 3R XM_318932.3 F: CGATCTGCTGGCCGACTTCC
R: CCATCGCCCTTGCGCTCACC
55 1 177 MM1 20
Overall 0.35 0.24 0.35
Fig. 1

Examples of agarose gel electrophoresis results for four primer pairs: a: positive amplifications with An. pseudopunctipennis. The size marker (lane 8) is a 1000 bp ladder with first band of 1000 bp and last band of 100 bp. Lanes 7 and 14 are negative controls (H2O). Lanes at the left side of the ladder correspond to results for primer pair no 3. Lanes 3, 4, 5 are An. pseudopunctipennis, while lanes 1, 2, 6 are An. gambiae (positive controls). Lanes at the right side of the ladder correspond to results for primer 9. Lanes 11, 12, 13 are An. pseudopunctipennis while lanes 9, 10 are An. gambiae (positive controls); b: negative amplifications with An. pseudopunctipennis. The size marker (lane 7) is a 1000 bp ladder with first band of 1000 bp and last band of 100 bp. Lane 6 is a negative control (H2O). Lanes at the left side of the ladder correspond to results for primer pair no 26. Lanes 1, 2, 3, 4 are An. pseudopunctipennis, while lane 5 is An. gambiae (positive control). Lanes at the right side of the ladder correspond to results for primer pair no 27. Lanes 8, 9, 10, 11, 12, 14 are An. pseudopunctipennis while lane 13 is An. gambiae (positive control).

2.4 Data analysis

Allele sizes were scored using the numerical procedure implemented in LabImage version 3.0 [37] using a size-standard 100 bp gene ruler. Observed (HO) and expected (HE) heterozygosities, the inbreeding coefficients (Fis statistics) and the R2 coefficient to estimate linkage disequilibrium for each locus pairs were computed using procedures implemented in the GENETIX package [38].

3 Results and discussion

Of the 54 selected pairs of primers, 14 pairs successfully amplified 17 loci (Table 2). All the 54 pairs of primers successfully amplified loci in An. gambiae. Forty pairs of primer did not amplify any loci in An. pseudopunctipennis while they did in An. gambiae. As an example, Fig. 1 presents results of agarose gel electrophoresis for four primers pairs. Fig. 1a shows positive amplifications in both An. pseudopunctipennis and An. gambiae while Fig. 1b gives examples of negative amplifications in An. pseudopunctipennis but positive ones in An. gambiae (positive controls). Because EPIC are universal primers they may amplify introns in other species. Table 3 is based on nucleotide BLAST (NCBI web site) of the 54 studied primers pairs and exhibits those that might amplify in a variety of other species including other mosquitoes (Aedes aegypti and Ae. albopictus, other five species of Anopheles, Culex quinquefasciatus), other Diptera (12 species of Drosophila), other insects (the cricket species Gryllus bimaculatus, the moths of the Noctuidae family Helicoverpa armigera and Heliotis viriplaca), the deer tick Ixodes scapularis, vertebrates (human, dog, mouse), a choanoflagelate Monosiga brevicolis, a cyanobacteria Thermosynechococcus elongates, a Dermatophytes zoophilic fungus Trichophyton verrucosum and even a plant, the common plantain Plantago major. Some primer pairs are more universal than others in the sense that, for example, primer pair no 4 (intron G3LEX28), primer pair no 11 (intron G3LEX36) or primer pair no 21 might amplify in 16, 11 and 7 species respectively. Of all the primer pairs studied, 11 might amplify in Ae. aegypti, the main vector of dengue viruses and 15 in C. quinquefasciatus, an annoying species also vector of human filariasis and West Nile virus (Table 3).

Table 3

Primer pairs and species in which they may potentially amplify, according to nucleotide sequence alignments using BLAST (NCBI).

Primer pair n°
Species 1 2 4 8 9 10 11 12 13 14 16 18 19
Aedes aegypti x x x x x x x
Ae. albopictus
Anopheles arabiensis x x
An. bwambae x
An. christyi x
An. merus x
An. quadrianulatus x
An. stephensi
Canis familiaris x
Culex quinquefasciatus x x x x x x x x
Drosophila melanogaster x x
D. ananassae x x
D. erecta x
D. grimshawi x x x
D. mojavensis x x
D. persimilis x x
D. pseudoobscura x x
D. sechellia x x
D. simulans x x
D. virilis x
D. willistoni x
D. yakuba x x
Gryllus bimaculatus x
Helicoverpa armigera x
Heliotis viriplaca x
Homo sapiens x
Ixodes scapularis x x x
Monosiga brevicolis x x
Mus musculus
Plantago major
Thermosynechococcus elongatus
Trichophyton verrucosum x
Number of species that might be recognized 1 2 16 1 2 5 11 1 4 2 2 5 2
Primer pair no
Species 20 21 22 29 31 34 35 36 37 38 43 50 54 Number or primer pairs that might amplify in the species
Aedes aegypti x x x x 11
Ae. albopictus x 1
Anopheles arabiensis 2
An. bwambae 1
An. christyi 1
An. merus 1
An. quadrianulatus 1
An. stephensi x 1
Canis familiaris 1
Culex quinquefasciatus x x x x x x x 15
Drosophila melanogaster x x x x x x 8
D. ananassae x x 4
D. erecta x x x 4
D. grimshawi x 4
D. mojavensis x 3
D. persimilis x 3
D. pseudoobscura x 3
D. sechellia x x 4
D. simulans x 3
D. virilis 1
D. willistoni 1
D. yakuba x x x x 6
Gryllus bimaculatus x 2
Helicoverpa armigera 1
Heliotis viriplaca 1
Homo sapiens x 2
Ixodes scapularis x 4
Monosiga brevicolis 2
Mus musculus x 1
Plantago major x 1
Thermosynechococcus elongatus x 1
Trichophyton verrucosum 1
Number of species that might be recognized 2 7 2 4 4 4 1 4 6 1 2 2 2

All the 17 loci amplified in An. pseudopunctipennis were tested for their polymorphism level using 20 An. pseudopunctipennis. Nine of the 17 amplified loci were polymorphic, ranging from two to four alleles (Table 2).

Previous studies relying on EPIC-PCR reported that various loci might be scored for a given pair of primers [11,32,39–41]. This phenomenon may reflect former polyploidizations, tandem duplications, and other phenomena occurring during lineage evolution and producing pseudogenes. Since An. pseudopunctipennis is a diploid species, gene duplication processes are more likely involved. The simultaneous amplification of two or three loci (two for G2LEX1236 and three for GUKEX1859) can then reveal the presence of another gene or a pseudogene. These simultaneous amplifications did not seem to disturb the quality of PCR and the reading of the genotypes because: the supplementary profiles did not present parasitic bands; and, the variation of size between band systems was larger than the size polymorphism of each locus. Indeed, when intraspecific allelic variants occur, a locus can be evidenced by the presence of all the allelic combinations following a Mendelian inheritance (homozygotes and heterozygotes); if not, in order to circumvent erroneous allelic assignment, only loci where the allelic size-variation is lower between orthologous than paralogous loci, should be retained [11].

With EPIC-PCR, artifacts such as null alleles are expected to be less frequent than for example, with microsatellites [42]. However, Table 2 exhibits some differences in the number of mosquitoes that correctly responded to amplification, in particular for primer pairs no 6 and 7 (Intron G3REX1037 and EX113, respectively, with 12 and 14 mosquitoes, respectively, instead of the 20 expected). A careful examination of results seemed to indicate the presence of null alleles for these primer pairs and moreover, no heterozygotes were encountered (Fis = 1). Therefore, these two primer pairs may not be suitable for population genetic studies. The lack of amplification in two mosquitoes for primers pairs no 1, 2, 4 and 5 are more likely the fact of PCR manipulation problems (low DNA concentration?) because the failure of amplification with the four above primer pairs occurred with the same two mosquitoes. Null alleles are therefore not suspected and these primer pairs may be proposed for genetic studies.

For the small population under study, the R2 coefficients to estimate linkage disequilibrium for each locus pair are presented in Table 4. Strong linkage disequilibrium appeared between G2REX47 and most of the other loci.

Table 4

R2 coefficients for linkage disequilibrium computed for each pair of polymorphic loci.

Intron names G2LEX1858 GUKEX1859-1 GUKEX1859-2 GUKEX1859-3 G3LEX28 G2REX47 G3REX1037 EX113
G2LEX1236-1 0.28 0.42 0.65 0.01 0.10 0.91 0.78 0.04
G2LEX1235-1 0.79 0.92 0.74 0.62 0.21 0.59 0.89
GUKEX1859-1 0.30 0.30 0.29 0.85 0.71 0.20
GUKEX1859-2 0.96 0.67 0.89 0.83
GUKEX1859-3 0.10 0.99 0.06 0.10
G3LEX28 0.90 0.21 0.01
G2REX47 0.02 0.52
G3REX1037

Compared with other DNA-based techniques such as microsatellites, EPIC-PCR is the only technique based on universal primers that allows a fast screening even for cross-species studies. Because An. pseudopunctipennis is likely a species complex [4,5], with at least five described subspecies [43] and two recognized morphological variants in Bolivian larvae [44], the above EPIC primers may therefore be used to better understand the species status.

Another interesting characteristic of EPIC-PCR is that, likely because gene duplication, one single pair of primer can produce more than one locus and can provide a number of polymorphisms, as it was the case with primer pair no 3 (intron GUKEX1859) in An. pseudopunctipennis.

Primer pairs no 2 and 4 indicate (at least in the small sample of 20 mosquitoes from Mataral village) that the genotype frequencies conform to Hardy-Weinberg equilibrium. Therefore, polymorphism in these introns may be selectively neutral, as predicted for variation in most non-coding DNA sequences. If so, such markers are particularly powerful in population genetics studies.

Population genetics of An. pseudopunctipennis will benefit of the above EPIC markers, and using recently available methods [27,42], other EPIC markers could be isolated more easily.

Disclosure of interest

The authors declare that they have no conflicts of interest concerning this article.

Acknowledgments

This project was partly supported by a PAL+ Grant from the Ministère de la Recherche (France) and a Contrat de Développement Grant from Ministère des Affaires Étrangères (France). The participation of R. Ursic-Bedoya in this study was possible thanks to the Association of Universities and Colleges of Canada (AUCC) and its Canada-Latin America and the Caribbean Research Exchange Grants. The authors would like to thank P. Kengne who encouraged this study and an anonymous referee whose comments helped us to greatly improve the manuscript.


References

[1] L.J. Bruce-Schwatt Essential Malariology, John Wiley & Sons, New York, 1985

[2] T.G.H. Aitken Studies on the anopheline complex of Western America, Univ. Calif. Pub. Entomol., Volume 7 (1945), pp. 273-364

[3] K.L. Knight; A. Stone, A Catalog of the Mosquitoes of the World (Diptera: Culicidae), vol. 6, The Thomas Say Foundation, Lanham, MD, 1977

[4] J.G. Estrada-Franco; M.C. Ma; R.W. Gwadz; R. Sakai; G.C. Lanzaro; A. Laughinghouse; C. Galvan-Sanchez; J.L. Cespedes; R. Vargas-Sagarnaga Evidence through crossmating experiments of a species complex in Anopheles pseudopunctipennis sensu lato: a primary malaria vector of the American continent, Am. J. Trop. Med. Hyg., Volume 49 (1993), pp. 746-755

[5] M. Coetzee; J.G. Estrada-Franco; C.A. Wunderlich; R.H. Hunt Cytogenetic evidence for a species complex within Anopheles pseudopunctipennis Theobald (Diptera: Culicidae), Am. J. Trop. Med. Hyg., Volume 60 (1999), pp. 649-653

[6] S. Manguin; D.R. Roberts; E.L. Peyton; I. Fernandez-Salas; M. Barreto; R. Fernandez-Loayza; R. Elqueta-Spinola; R. Martinez-Granaou; M.H. Rodriguez Biochemical systematics and population genetic structure of Anopheles pseudopunctipennis, vector of malaria in Central and South America, Am. J. Trop. Med. Hyg., Volume 53 (1995), pp. 362-377

[7] E.P. Lessa Rapid survey of DNA sequence variation in natural populations, Mol. Biol. Evol., Volume 9 (1992), pp. 323-330

[8] S.R. Palumbi; C.S. Baker Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales, Mol. Biol. Evol., Volume 11 (1994), pp. 426-435

[9] R.W. Slade; C. Moritz; A. Heideman; P.T. Hale Rapid assessment of single-copy nuclear DNA variation in diverse species, Mol. Ecol., Volume 2 (1993), pp. 359-373

[10] P. Berrebi; X. Retif; F. Fang; C.G. Zhang Population structure and systematics of Opsariichthys bidens (Osteichthyes: Cyprinidae) in south-east China using a new nuclear marker: the introns (EPIC-PCR), Biol. J. Linn. Soc., Volume 87 (2006), pp. 155-166

[11] N. Hubert; F. Duponchelle; H. Nunez; R. Rivera; J.-F. Renno Evidence of reproductive isolation among closely related sympatric species of Serrasalmus (Ostariophysii, Characidae) from the Upper Madeira River, Amazon, Bolivia, J. Fish Biol., Volume 68 (2006), pp. 1-21

[12] N. Backström; S. Fagerberg; H. Ellegren Genomics of natural bird populations: a gene-based set of reference markers evenly spread across the avian genome, Mol. Ecol., Volume 17 (2008), pp. 964-980

[13] W.T. Tay; G.T. Behere; D.G. Heckel; S.F. Lee; P. Batterham Exon-primed intron crossing (EPIC) PCR markers of Helicoverpa armigera (Lepidoptera: Noctuidae), Bull. Ent. Res., Volume 98 (2008), pp. 509-518

[14] N.M. Endersby; A.A. Hoffmann; V.L. White; S. Lowenstein; S. Ritchie; P.H. Johnson; L.P. Rapley; P.A. Ryan; V.S. Nam; N.T. Yen; P. Kittiyapong; A.R. Weeks Genetic structure of Aedes aegypti in Australia and Vietnam revealed by microsatellite and Exon Primed Intron Crossing markers suggests feasibility of local control options, J. Med. Entomol., Volume 46 (2009), pp. 1074-1083

[15] J. Dixit; H. Srivastava; O.P. Singh; D.N. Saksena; A. Das Multilocus nuclear DNA markers and genetic parameters in an Indian Anopheles minimus population, Infec. Genet. Evol., Volume 11 (2011), pp. 572-579

[16] M. He; D.S. Haymer Polymorphic intron sequences detected within and between populations of the Oriental Fruit Fly (Diptera: Tephritidae), Ann. Ent. Soc. Am., Volume 90 (1997), pp. 825-831

[17] S. Creer; A. Malhotra; R.S. Thorpe; C.E. Pook Targeting optimal introns for phylogenetic analyses in non-model taxa: experimental results in Asian pitvipers, Cladistics, Volume 21 (2005), pp. 390-395

[18] S. Creer Choosing and using introns in molecular phylogenetics, Evol. Bioinfo., Volume 3 (2007), pp. 99-108

[19] K.S. Wydner; J.L. Sechler; C.D. Boyd; H.C. Passmore Use of an intron polymorphism to localize the tropoelastin gene to mouse chromosome 5 in a region of linkage conservation with human chromosome 7, Genomics, Volume 23 (1994), pp. 125-131

[20] Y. Yasukochi; L.A. Ashakumary; K. Baba; A. Yoshido; K. Sahara A second generation integrated map of the silkworm reveals synteny and conserved gene order between lepidopteran insects, Genetics, Volume 173 (2006), pp. 1319-1328

[21] E.G. Pringle; S.W. Baxter; C.L. Webster; A. Papanicolaou; S.F. Lee; C.D. Jiggins Synteny and chromosome evolution in the Lepidoptera: evidence from mapping in Heliconius melpomene, Genetics, Volume 177 (2007), pp. 417-426

[22] N. Backström; M. Brandström; L. Gustafsson; A. Qvarnström; H. Cheng; H. Ellegren A gene-based genetic linkage map of the collared flycatcher (Ficedula albicollis) reveals extensive synteny and gene-order conservation during 100 million years of Avian evolution, Genetics, Volume 179 (2008), pp. 1479-1495

[23] J. Slate; J. Gratten; D. Beraldi; J. Stapley; M. Hale; J.M. Pemberton Gene mapping in the wild with SNPs: guidelines and future directions, Genetica, Volume 136 (2009), pp. 97-107

[24] J.A. Wilder; H. Hollocher Recent radiation of endemic Caribbean Drosophila of the dumni subgroup inferred from multilocus DNA sequence variation, Evolution, Volume 57 (2003), pp. 2566-2579

[25] A. Das; S. Mohanty; W. Stephan Inferring the population structure and demography of Drosophila ananasae from multilocus data, Genetics, Volume 168 (2004), pp. 1975-1985

[26] P. Berrebi; E. Boissin; F. Fang; G. Berrebi-Cattaneo Intron polymorphism (EPIC-PCR) reveals phylogeographic structure of Zacco platypus in China: a possible target for aquaculture development, Heredity, Volume 94 (2005), pp. 589-598

[27] C. Li; J.J. Riethoven; L. Ma Exon-primed intron crossing (EPIC) markers for non-model teleost fishes. BMC, Evol. Biol., Volume 10 (2010), p. 90 (doi:10.1186/147121481090)

[28] K. Lohse; B. Sharanowski; M. Blaxter; J.A. Nicholls; G.N. Stone Developping EPIC markers for chalcidoid Hymenoptera from EST and genomic data, Mol. Ecol. Res., Volume 11 (2011), pp. 521-529

[29] R.C. Thomson; I.J. Wang; J.R. Johnson Genome-enabled development of DNA markers for ecology, evolution and conservation, Mol. Ecol., Volume 19 (2010), pp. 2184-2195

[30] N. Bierne; S.A. Lehnert; E. Bédier; F. Bonhomme; S.S. Moore Screening for intron-length polymorphism in paenid shrimps using exon-primed intron-crossing (EPIC)-PCR, Mol. Ecol., Volume 9 (2000), pp. 233-235

[31] H.B.S.M. Côrte-Real; D.R. Dixon; P.W.H. Holland Intron-targeted PCR: a new approach to survey neutral DNA polymorphism in bivalve populations, Mar. Biol., Volume 120 (1994), pp. 407-413

[32] T. Atarhouch; M. Rami; G. Cattaneo-Berrebi; C. Ibanez; S. Augros; E. Boissin; A.L. Dakkak; P. Berrebi Primers for EPIC amplification of intron sequences for fish and other vertebrate population genetic studies, BioTech., Volume 3 (2003), pp. 676-682

[33] L.M. Gomulski; K. Bourtzis; S. Brogna; P.A. Morandi; C. Bonvicini; F. Sebastiani; C. Torti; C.R. Guglielmino; C. Savakis; G. Gasperi; A.R. Malacrida Intron size polymorphism of the Adh1 gene parallels the worldwide colonization history of the Mediterranean fruit fly, Ceratitis capitata, Mol. Ecol., Volume 7 (1998), pp. 1729-1741

[34] A.J. Bohonak; N. Davies; F.X. Villablanca; G.K. Roderick Invasions genetics of New World medflies: testing alternative colonization scenarios, Biol. Invasions, Volume 3 (2001), pp. 103-111

[35] J.R. Gorham; C.J. Stojanovich; H.G. Scott Clave illustrada para los mosquitos Anofelinos de Sudamerica Occidental (Illustrated key to the Anopheline mosquitoes of Western South America), Mosq. Syst., Volume 5 (1973), pp. 97-156

[36] J.K. Edwards Miniprep procedures for the isolation of plant DNA (A. A. Karp; P.G. Issac; Ingram, eds.), Molecular tools for screening biodiversity, Chapman & Hall, London, 1998, pp. 22-24

[37] LabImage, Gel Analysis Software. Halle, Kapelan GmbH, 2005.

[38] K. Belkhir; P. Borsa; J. Goudet; L. Chikhi; F. Bonhomme GENETIX, Logiciel sous WindowsTM pour la Génétique des Populations, Laboratoire Génome et Populations, CNRS UPR 9060, Univ.Montpellier II, Montpellier, France, 1998

[39] M. Hassan; M. Harmelin-Vivien; F. Bonhomme Lessepsian invasion without bottleneck: example of two rabbitfish species (Siganus rivulatus and Siganus luridus), J. Exp. Mar. Biol. Ecol., Volume 291 (2003), pp. 219-232

[40] S.C. France; N. Tachino; T.F. Duda; R.A. Schleser; S.R. Palumbi Intraspecific genetic diversity in the marine shrimp Penaeus vannamei: multiple polymorphic elongation factor-1a loci revealed by intron sequencing, Mar. Biotech., Volume 1 (1999), pp. 261-268

[41] P. Borsa; A. Collet; J.-D. Durand Nuclear-DNA markers confirm the presence of two anchovy species in the Mediterranean, C. R. Biologies, Volume 327 (2004), pp. 1113-1123

[42] A. Chenuil; T.B. Hoareau; E. Egea; G. Penant; C. Rocher; D. Aurelle; K. Mokhtar-Jamai; J.D.D. Bishop; E. Boissin; A. Diaz; M. Krakau; P.C. Luttikhuizen; F.P. Patti; N. Blavet; S. Mousset An efficient method to find potentially universal genetic markers, applied to metazoans, BMC Evol. Biol., Volume 10 (2010), p. 276 (doi: 10.1186/1471214810276)

[43] Walter Reed Biosystematics Unit website: http://www.mosquitocatalog.org/taxon_descr.aspx?ID=18300.

[44] F. Lardeux; T. Chavez; R. Rodriguez; L. Torrez Anopheles of Bolivia: new records with an updated and annotated checklist, C.R. Biologies, Volume 332 (2009), pp. 489-499


Comments - Policy