Outline
Comptes Rendus

Molecular biology and genetics/Biologie et génétique moléculaires
The complete mitochondrial genome of the Tibetan fox (Vulpes ferrilata) and implications for the phylogeny of Canidae
Comptes Rendus. Biologies, Volume 339 (2016) no. 2, pp. 68-77

Abstract

Canidae is a family of carnivores comprises about 36 extant species that have been defined as three distinct monophyletic groups based on multi-gene data sets. The Tibetan fox (Vulpes ferrilata) is a member of the family Canidae that is endemic to the Tibetan Plateau and has seldom been in the focus of phylogenetic analyses. To clarify the phylogenic relationship of Vferrilata between other canids, we sequenced the mitochondrial genome and firstly attempted to clarify the relative phylogenetic position of Vferrilata in canids using the complete mitochondrial genome data. The mitochondrial genome of the Tibetan fox was 16,667 bp, including 37 genes (13 protein-coding genes, 2 rRNA, and 22 tRNA) and a control region. A comparison analysis among the sequenced data of canids indicated that they shared a similar arrangement, codon usage, and other aspects. A phylogenetic analysis on the basis of the nearly complete mtDNA genomes of canids agreed with three monophyletic clades, and the Tibetan fox was highly supported as a sister group of the corsac fox within Vulpes. The estimation of the divergence time suggested a recent split between the Tibetan fox and the corsac fox and rapid evolution in canids. There was no genetic evidence for positive selection related to high-altitude adaption for the Tibetan fox in mtDNA and following studies should pay more attention to the detection of positive signals in nuclear genes involved in energy and oxygen metabolisms.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2015.11.005
Keywords: Tibetan fox, Canidae, Mitochondrial genome, Phylogeny, Divergence time

Chao Zhao  1 ; Honghai Zhang  1 ; Guangshuai Liu  2 ; Xiufeng Yang  1 ; Jin Zhang  1

1 College of Life Science, Qufu Normal University, Qufu, China
2 College of Wildlife Resources, Northeast Forestry University, Harbin, China
Chao Zhao; Honghai Zhang; Guangshuai Liu; Xiufeng Yang; Jin Zhang. The complete mitochondrial genome of the Tibetan fox (Vulpes ferrilata) and implications for the phylogeny of Canidae. Comptes Rendus. Biologies, Volume 339 (2016) no. 2, pp. 68-77. doi: 10.1016/j.crvi.2015.11.005
@article{CRBIOL_2016__339_2_68_0,
     author = {Chao Zhao and Honghai Zhang and Guangshuai Liu and Xiufeng Yang and Jin Zhang},
     title = {The complete mitochondrial genome of the {Tibetan} fox {(\protect\emph{Vulpes} ferrilata}) and implications for the phylogeny of {Canidae}},
     journal = {Comptes Rendus. Biologies},
     pages = {68--77},
     year = {2016},
     publisher = {Elsevier},
     volume = {339},
     number = {2},
     doi = {10.1016/j.crvi.2015.11.005},
     language = {en},
}
TY  - JOUR
AU  - Chao Zhao
AU  - Honghai Zhang
AU  - Guangshuai Liu
AU  - Xiufeng Yang
AU  - Jin Zhang
TI  - The complete mitochondrial genome of the Tibetan fox (Vulpes ferrilata) and implications for the phylogeny of Canidae
JO  - Comptes Rendus. Biologies
PY  - 2016
SP  - 68
EP  - 77
VL  - 339
IS  - 2
PB  - Elsevier
DO  - 10.1016/j.crvi.2015.11.005
LA  - en
ID  - CRBIOL_2016__339_2_68_0
ER  - 
%0 Journal Article
%A Chao Zhao
%A Honghai Zhang
%A Guangshuai Liu
%A Xiufeng Yang
%A Jin Zhang
%T The complete mitochondrial genome of the Tibetan fox (Vulpes ferrilata) and implications for the phylogeny of Canidae
%J Comptes Rendus. Biologies
%D 2016
%P 68-77
%V 339
%N 2
%I Elsevier
%R 10.1016/j.crvi.2015.11.005
%G en
%F CRBIOL_2016__339_2_68_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

The mitochondrial genome (mtDNA) has been used as an ideal marker of molecular evolutionary studies over the past three decades because of its convenience for the reconstruction of phylogeny, inference of population history, and estimation of divergence time [1–5]. mtDNA typically comprises a small closed circular DNA strand that generally encodes 37 genes: 13 protein-coding genes (PCGs), 2 rRNAs, and 22 tRNAs [6–8]. Compared with nuclear genes, mtDNA is characteristic of maternal inheritance, a high substitution rate, an absence of recombination, and a high copy number, which make it more effective in analyses [7,9,10]. In addition, the proteins involved in oxidative phosphorylation have provided insight into the molecular basis of adaptation to extreme environments [8,11–13].

Canidae is a family of carnivores that comprises about 36 extant species with a worldwide distribution [14]. Because of their close relationship with mankind, a great deal of attention has been devoted to studies on canids, including studies on their physiology, behavior, origins, and evolutionary relationships [15–17]. In recent decades, phylogenetic analyses based on morphologic and molecular data have been conducted for most extant canids and the most definitive analysis made use of a data set that combined three mitochondrial genes (COI, COII, and CYTB) [17–22]. Three distinct monophyletic groups within the family Canidae were defined as follows:

  • • the wolf-like canids, including the genera Canis, Lycaon, and Cuon;
  • • the fox-like canids, including the genera Vulpes, Alopex, and Fennecus;
  • • the South American canids, including the genera Pseudolopex, Lycolopex, Atelocynus, Chrysocyon, and Speothos.

As more morphological and molecular characteristics have been combined and analyzed, some phylogenetic issues (e.g., the phylogenetic positions of Chrysocyon brachyurus and Speothos venaticus) have become better resolved and the monophyly of these three clades are well supported [20,22]. Furthermore, some phylogeneticists have focused on the divergence time issues to comprehend the evolution history of the Canidae, although there are several points of conflict because of differences in molecular markers and fossil calibration points [22,23]. To date, only these three mitochondrial genes have been applied to illustrate the phylogenetic relationship of canids. The control region has been used to clarify intraspecies relationships among wolves from various areas because of its relatively homogeneous evolutionary rates [24]. Furthermore, the genome wide analysis indicated that the wolves inhabited in the Qinghai–Tibet Plateau were separated from the lowland ones, which was consistent with the geographic distribution of the wolf population in China [25].

The recent development of sequencing technologies makes it practical to sequence the complete mitochondrial genome at a reasonable cost. Unlike partial mtDNA markers, the complete mtDNA contains an increased phylogenetic signal with reduced effects of homoplasy [9], and the order of the mitochondrial genes provides more accurate information that allows it to be widely used as a highly heterogeneous marker in evolutionary studies [4,6,26–28]. With the recent rapid growth in the taxonomic coverage of complete mtDNA sequences, the analysis of mtDNA sequences has proven useful in the clarification of the colonization of two lineages of wolves in Japan [10], the origin and domestication history of dogs [1], and phylogenetic issues among various vertebrate taxa [29].

A member of the family Canidae (Carnivora), the Tibetan fox (Vferrilata) is an endemic species that is widely distributed in the steppes and semi-deserts of the Tibetan Plateau north across central China, Nepal, and northern India [30]. According to the International Union for Conservation of Nature and Natural Resources, the Tibetan fox is listed as of “least concern”; however, hunting and habitat destruction by humans are the main threats to its population [30]. Little biological and ecologic information, especially phylogeny based on molecular data, is available because this species is rarely involved in phylogenetic analyses of the canids [17,31]. All aspects of the fox's natural history need study [32], and the complete mtDNA sequence of this species would be conducive to studies on molecular phylogeny, population conservation, and even further elucidation of its high-altitude adaptations. In this study, we present the complete mtDNA genome of the Tibetan fox and compare its structure and composition with other complete canine mtDNAs that have already been published. We also performed a phylogenetic analysis based on the complete mtDNA genome and estimated the divergence times, with the intention of resolving the phylogenetic relationship between this species and other canids.

2 Materials and methods

2.1 Specimen collection and DNA extraction

The sample that was used to sequence the complete mtDNA was taken from a specimen of Tibetan fox preserved in the Wildlife Park of Xining. The Tibetan fox died a natural death and then was made specimen in 2013. Permission to collect and use the sample was issued by Xining Wildlife Park. We snipped the pelage close to the anus to avoid affecting the appearance of this specimen. The total genomic DNA of the Tibetan fox was extracted using a DNeasy blood and tissue kit (Qiagen) and was examined on a 1.0% agarose/TBE gel.

2.2 Polymerase chain reaction amplification and sequencing

We designed 12 primer pairs with Primer 5.0 on the basis of the alignment of the complete mtDNA of Vvulpes (GQ374180) and Vcorsac (KJ140137), and the primers were modified by sequencing (Table 1). The fragments were amplified using Taq DNA polymerase (TaKaRa) under the following conditions: initial denaturation at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 50 to 56 °C for 30 s, extension at 72 °C for 1 min 45 s to 2 min 45 s, and a final extension at 72 °C for 10 min. All of the polymerase chain reaction products were cloned into the PMD™18-T Vector Cloning Kit (TaKaRa) and then bidirectionally sequenced using the ABI 3730XL Genetic Analyzer (PE Applied Biosystems, San Francisco, CA, USA).

Table 1

Primer sequences used in this study.

Primer No Primer ID Forward and reverse primer sequence (5′–3′)
1 1-F TCCCTCTAGAGGAGCCTGTTC
1-R TCCGAGGTCACCCCAACC
2 2-F GACGAGAAGACCCTATGGAGC
2-R GGGTATGGGCCCGATAGCTT
3 3-F GTCTGACAAAAGAGTTACTTTGATAGAG
3-R ACCTACTATACCGGCCCATGC
4 4-F GCTCAGCCATTTTACCTATGTTC
4-R GCGAATTTAACTTTGACAAAGTCATGT
5 5-F GAAGAAAGGAAGGAATCGAACC
5-R GCGAAGAGTTGTAGTGAAATCATAT
6 6-F GCTACCTAATGACCCACCAAAC
6-R GCGTAGGGATGATAATTTTTAGCATT
7 7-F GTATTTGCTGCCTGCGAAGC
7-R CGCTTATCTGGAGTTGCACC
8 8-F CCGCAAGAACTGCTAATTCATG
8-R TAGTGGTGGGATTGGTTGTGC
9 9-F TTCATGTGCTCCGGGTCAATTATC
9-R ATTCCATGTGGGAATAATGATAAC
10 10-F TCGTAACAAATCCCACAAAGCTC
10-R CAAGACCAATGTAATTAGTATACT
11 11-F TAATGCCAACCATTAGCATTATC
11-R ACGACTCATCTTGGCATTTTCAG
12 12-F CGCGATGAAGAGTCTTTGTAGTAT
12-R GGTTTGCTGAAGATGGCGGTATAT

2.3 Sequence analysis

The complete mtDNA sequence was assembled using the programs BioEdit and Chromas, and adjusted manually. The 13 PCGs and rRNA genes were identified by alignment with other known complete mtDNA sequences of foxes and annotated using Sequin. The 22 tRNA genes were identified using the tRNA Scan-SE 1.21 (http://lowelab.ucsc.edu/tRNAscan-SE) and the program ARWEN. The base composition and codon usage were analyzed with MEGA 4.0 [33].

2.4 Phylogenetic analysis

Phylogenetic reconstruction was performed among the newly sequenced and other available complete mtDNA of canids using the ML and the Bayesian inference methods, with Felis catus (NC_001700) used as outgroup. A concatenated data set of 2 rRNAs, and 12 PCGs (without ND6) was aligned with the Clustal X program, followed by manual adjustment. In the ML analysis, the best-fit model (GTR + I + G) of sequence evolution was selected using Modeltest 3.7 [34] based on the AIC criterion, and the model and its parameters were then used in PAUP 4.0b10 with a heuristic algorithm and TBR branch swapping. The reliability of the ML tree was evaluated with a bootstrap test with 1000 replicates. The model and parameters were also used in the Bayesian analysis [35]. Four Metropolis-coupled Markov chain Monte Carlo analyses were run for 2,000,000 generations. The chains were sampled every 1000 generations with the discard of the first 25% as burn-in. The remaining trees were used to construct a 50% majority-rule consensus tree and to summarize the posterior probabilities.

2.5 Divergence time estimation

The estimates of divergence time were calculated using the uncorrelated lognormal relaxed clock in program BEAST 1.8 [36]. The input dataset combined 2 rRNAs and 12 PCGs from 18 complete mtDNA sequences, with a GTR substitution model and the speciation Yule process applied. Three fossil constraints used as time priors in our analysis had been used in an earlier study to infer the divergence time of South American canids [22]. The priors used were the split of Canidae/Ursidae, Ailuropoda/Ursus, and Canini/Vulpini, and each was constrained by a Gamma prior with values younger than 40 Ma, 7.5 Ma, and 8 Ma, respectively, which were justified by fossil records. In this analysis, 50,000,000 generations were conducted and sampled every 1000 generations. A 25% burn-in value was removed under TreeAnnotator 1.8, and the retained samples were combined. Finally, the phylogenetic tree was viewed and edited in FigTree 1.4.

2.6 Selection constraint tests

To examine the functional implication and the selective pressures in the mtDNA of the Tibetan fox, we estimated the ratio of non-synonymous to synonymous substitution rates (ω) using a likelihood approach. We used three tests, including M0, two-ratio and M1 models, conducted in the codeml program in PAML package. The combined dataset of 13 protein-coding genes was from the Tibetan fox and other five canids. We also undertook the branch-site model for stringent testing and identification of sites under positive selection and constructed likelihood ratio tests (LRT).

3 Results

3.1 Mitochondrial genome organization of the Tibetan fox and comparison with other canids

The complete mitochondrial genome of the Tibetan fox was 16,667 bp in length (GenBank accession number KT033906) and contained all 37 genes (13 PCGs, 2 rRNA genes, and 22 tRNA genes) and a control region (D-loop), as usually present in animal mtDNA genome (Table 2). Its organization and gene arrangement pattern were identical to those of the typical vertebrate mtDNA sequences. The heavy strand (H-strand) contained 28 genes (12 PCGs, 2 rRNA genes, and 14 tRNA genes), and the rest, including ND6 and 8 tRNA genes, were oriented on the light strand (L-strand).

Table 2

Organization of the mitochondrial genome of the Tibetan fox (Vulpes ferrilata).

Gene Location (bp) Size (bp) Spacer (+) or Overlap (–) Strand Start codon Stop codon Anticodon
tRNAPhe 1–69 69 0 H GAA
12S rRNA 70–1026 957 0 H
tRNAVal 1027–1093 67 0 H TAC
16S rRNA 1094–2672 1579 0 H
tRNALeu(UUR) 2673–2747 75 2 H TAA
ND1 2750–3705 956 0 H ATG TA–
tRNAIle 3706–3774 69 –3 H GAT
tRNAGln 3772–3845 74 1 L TTG
tRNAMet 3847–3916 70 0 H CAT
ND2 3917–4958 1042 0 H ATA T––
tRNATrp 4959–5026 68 12 H TCA
tRNAAla 5039–5107 69 1 L TGC
tRNAAsn 5109–5179 71 0 L GTT
OL 5180–5216 37 –3 L
tRNACys 5214–5281 68 0 L GCA
tRNATyr 5282–5349 68 1 L GTA
COXI 5351–6895 1545 –3 H ATG TAA
tRNASer(UCN) 6893–6961 69 6 L TGA
tRNAAsp 6968–7035 68 0 H GTC
COXII 7036–7719 684 17 H ATG TAA
tRNALys 7737–7803 67 1 H TTT
ATPase8 7805–8008 204 –43 H ATG TAA
ATPase6 7966–8646 681 –1 H ATG TAA
COXIII 8646–9429 784 0 H ATG T––
tRNAGly 9430–9497 68 0 H TCC
ND3 9498–9843 346 –1 H ATA T––
tRNAArg 9843–9913 71 0 H TCG
ND4L 9914–10,210 297 –7 H ATG TAA
ND4 10,204–11,581 1378 0 H ATG T––
tRNAHis 11,582–11,650 69 0 H GTG
tRNASer(AGY) 11,651–11,710 60 0 H GCT
tRNALeu(CUN) 11,711–11,780 70 0 H TAG
ND5 11,781–13,601 1821 –17 H ATA TAA
ND6 13,585–14,112 528 0 L ATG TAA
tRNAGlu 14,113–14,181 69 4 L TTC
Cytb 14,186–15,325 1140 0 H ATG AGA
tRNAThr 15,326–15,395 70 –1 H TGT
tRNAPro 15,395–15,460 60 0 L TGG
D-loop 15,461–16,667 1207 H

A comparison analysis performed between the newly sequenced Canidae mitochondrial genome and earlier reported genomes indicated that the genomes were similar in many respects [37]. The total length of the mtDNA genomes of these canids varied from 16,469 to 16,767 bp, which was concerned primarily with the variable control region. The nucleotide composition of the Tibetan fox mtDNA sequence was 31.20% A, 27.81% T, 26.07% C, and 14.92% G, and a strong A + T bias (59.01%) was found in this genome. The comparative analysis of the nucleotide compositions among canids indicated that they shared a similar strong A + T bias (varying from 57.60% to 61.62%) and nucleotide composition order, except that C (27.21%) had a slightly greater presence than T (26.68%) in Vzerda (Table 3). More interestingly, the fox-like canids, Nyctereutes procyonoides and Urocyon littoralis possessed a lower A + T content without exceeding 60.00%, and the values were higher in the rest of the canids. The AT-skew and GC-skew values of the canids’ mtDNA sequences were consistent with the rule that the AT-skew value is positive and the GC-skew value is negative in amniote mtDNA[38].

Table 3

Bsae composition (%) of the sequenced Canidae mitochondrial genomes.

Species Total length (bp) A (%) T (%) C (%) G (%) A + T content (%) AT-skew GC-skew
Vulpes ferrilata 16,667 31.20 27.81 26.07 14.92 59.01 0.057 –0.272
Vulpes zerda 16,734 30.93 26.68 27.21 15.18 57.60 0.074 –0.284
Vulpes vulpes 16,723 31.32 27.76 26.13 14.79 59.08 0.060 –0.277
Vulpes corsac 16,721 31.38 27.95 25.88 14.79 59.33 0.058 –0.273
Vulpes lagopus 16,629 31.29 27.77 26.15 14.79 59.06 0.060 –0.277
Chrysocyon brachyurus 16,760 32.15 29.47 24.58 13.80 61.62 0.044 –0.281
Cuon alpinus 16,767 31.56 29.46 24.64 14.34 61.02 0.035 –0.264
Canis latrans 16,724 31.61 28.75 25.50 14.14 60.36 0.047 –0.286
Canis lupus 16,729 31.61 28.71 25.54 14.14 60.32 0.048 –0.287
Canis anthus 16,721 31.40 28.84 25.32 14.44 60.24 0.043 –0.274
Nyctereutes procyonoides 16,713 32.09 26.97 26.72 14.22 59.06 0.087 –0.305
Urocyon littoralis 16,469 30.79 27.64 26.35 15.22 58.43 0.054 –0.268

The 13 PCGs that are present in the complete mtDNA genomes of canids were arranged in the same gene order and share the common codon usage bias (Table 4). The truncated stop codons TA– and T–– were used in several genes; it was presumed that they were restored by post-transcriptional polyadenilation. Some special cases were detected across these species, such as ND4L starting with GTG in Clupus, which was also used as the start codon in COXI among Anseriformes [5]. The A + T content of 13 PCGs in these canids ranged from 56.59% to 61.61%, and the strongest T bias (around 42%) and the lowest content of G (between 6.07% and 11.08%) were detected in the second and third codon positions, respectively.

Table 4

Start and stop codons for 13 PCGs in mitochondrial genome of Canidae species.

PCG A B C D E F G H I J K L
ND1 ATG/TA– ATG/TA– ATG/TA– ATG/TA– ATG/TA– ATG/TA– ATG/TA– ATG/TAA ATG/TAA ATG/TA– ATG/TA– ATG/TA–
ND2 ATA/T–– ATA/T–– ATA/T–– ATA/T–– ATA/T–– ATA/T–– ATA/T–– ATA/TAG ATA/TAG ATA/TAG ATA/T–– ATA/T––
COXI ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA
COXII ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA
ATP8 ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA
ATP6 ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA
COXIII ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T––
ND3 ATA/T–– ATA/T–– ATT/TA– ATA/T–– ATA/TA– ATA/TA– ATA/TA– ATA/TA– ATA/T–– ATA/TA– ATA/TA– ATA/T––
ND4L ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA GTG/TAA ATG/TAA ATG/TAA ATG/TAA
ND4 ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T–– ATG/T––
ND5 ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA ATA/TAA
ND6 ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA ATG/TAA
Cytb ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA ATG/AGA

The control region had the most variable length among the canids’ complete mitochondrial genomes, ranging from 1004 bp (Ulittoralis) to 1307 bp (Cuon alpinus), mainly because of the variation in the number and length of the tandemly repeated sequences. The control region is formed by a central conserved domain and two peripheral domains. All of the conserved sequence blocks previously found in mammals were identified in the canids’ control regions, with CSB-B–F in the central conserved domain and CSB-1–3 in the right domain (Table 5). Furthermore, the mentioned GCCCC motif and termination-associated sequences (TAS-A) related to the termination of H-strand replication and displacement of the original H-strand, respectively, were detected in these analyses. The TAS-A exhibited a relatively high level of nucleotide substitutions among these canids. The regions comprising tandem repeats were located between CSB-1 and CSB-2, and the repeats varied across species. The fox-like canids (except Vlagopus) and Nprocyonoides shared the same repeat (5′-ACA(G)CACGT-3′), whereas the repeats 5′-ACGT-3′ and 5′-ACACGT-3′ arose in Vvulpes and Vzerda, respectively. The wolf-like canids and Chrysocyon brachyurus exhibited the same repeat (5′-ACACGTA(G)C(T)GT-3′). The copy number and the total length of the tandem repeats in this region showed variation even within the same species.

Table 5

D-loop termination, TAS-A, and eight CSBs in control region of the sequenced Canidae species.

D-loop termination TAS-A CSB-F CSB-E
Vulpes ferrilata GCCCCATGCATATAAGCAAGTACATACGTCTATGAAATTACATAAGA ACCATGCCTCGAGAAACCATCAACCCTTGC CTCTTCTCGCTCCGGGCCCATACCAACGTGGGGGTTTC
Vulpes zerda ..................T.......TA.....ATC........... .......................T...... .....................TT...............
Vulpes vulpes ..............G...T.......TACT...AT............ .......................T...... ......................T...............
Vulpes corsac .................................A............. .............................. ......................TT...........G..
Vulpes lagopus ..................T.......TA.T...ATT........... .......................T...... ......................T...............
Chrysocyon brachyurus ..................T.......TTAT...ATCC.......G.. .......................T...... ......................T...............
Cuon alpinus ..................T.......TTAT...ATCC.......G.. .......................T...... .....................G.T..T...........
Canis latrans ..................T.......ATAT...ATCT.......G.. .......................T...... ......................T...............
Canis lupus ..................T.......ATAT...ATCC.......G.. .............................. .......................T............A.
Canis anthus ..................T.......TTAT..CATTC.......... .............................. .......................T............A.
Nyctereutes procyonoides ..........................TTCA.GCATTG.C...AT... .............................. ......................................
Urocyon littoralis ..................T........TG..A.GAA........... .......................T...... .......................-..............
CSB-D CSB-C CSB-B CSB-1 CSB-2 CSB-3
ATCTGGTTCTTACCTCAGGGCCATT TCTCAAATGGGACATCTCGATGG TCATGCATTTGGTATCTTTT TTCAGTCAATGGTTTCAGGACATA ACCCCCCTTACCCCCCG TGCCAAACCCCAAAAAC
......................... ....................... .................... ..............A......... ................A .................
......................... ....................... .................... ........................ ................. C................
........................C ....................... .................... ........................ ................. C................
......................... ....................... .................A.. ........GC.............. ................A .................
........................G ....................... .................... ........................ ................. .................
........................G .TG.................... .................... ........................ ...............-A .................
........................G .TG.................... .................... ........................ ................A C................
........................A ..G.................... .................... ........................ ................. C................
........................A .TG..............A..... ........C........... ........................ ................A C................
........................G A...................... .................... ..............A......... ................A C................
.............T..........G ....................... .................... ........................ ................. .................

3.2 Phylogenetic reconstructions

The phylogenetic trees generated from maximum likelihood (ML) analyses and Bayesian inferences have the same topologies (Fig. 1). Most analyzed species have been divided into three monophyletic clades: the fox-like canids, including all Vulpes; the wolf-like canids, including Canis and Cuon; and the South American canids, Chrysocyon brachyurus, which was consistent with the three previously published and well-defined clades based on mitochondrial genes. In these analyses, the wolf-like clade and the South American clade were identified as sister groups and were then grouped together with the fox-like clade. In both trees, the Tibetan fox was classified in the fox-like clade, with the closest relationship to the corsac fox (Vcorsac) (bootstrap support, 100%; posterior probability, 1.00), and Vlagopus and Vvulpes were placed as successively more closely related to them. The phylogenetic position of the raccoon dog (Nprocyonoides) was revealed as a sister group of Vulpes, with highly significant Bayesian posterior probabilities (1.00), although the bootstrap support (65%) was lower in the ML analysis. Urocyon was basal to all other canids in both trees (bootstrap support, 100%; posterior probability, 1.00).

Fig. 1

Phylogenetic relationships among the sequenced Canidae species. Numbers at each node are Bayesian posterior probabilities (left) and ML bootstrap proportions (right). The sequence accession numbers are Vulpes zerda (KJ603240), Vulpes vulpes (GQ374180), Vulpes vulpes montana (KF387633), Vulpes corsac (KJ140137), Vulpes lagopus (KP342451), Chrysocyon brachyurus (KJ508409), Cuon alpinus (KF646248), Canis latrans (NC008093), Canis lupus campestris (KC896375), Canis lupus laniger (KF573616), Canis anthus (NC027956), Nyctereutes procyonoides (NC013700), Urocyon littoralis (KP128949), Ailuropoda melanoleuca (NC009492), Ursus americanus (NC003426), Martes zibellina (NC011579), Felis catus (NC001700).

3.3 Divergence time estimation

The estimation of the divergence time on the basis of the mtDNA genomic data placed the time of the most recent common ancestor of canids at 10.4 Ma, with a 95% highest probability density (HPD) from 8.42 Ma to 12.61 Ma (Fig. 2). The raccoon dog was the earliest species to split from the other canids in this analysis, which took place at approximately 7.63 Ma (95% HPD, 6.46 to 8.79 Ma). Lineage-splitting events between Chrysocyon and Canis+Cuon occurred around 4.99 Ma (95% HPD, 3.57 to 6.42 Ma). The diversification among Vulpes was estimated to have occurred over a rather long interval, with Vzerda the first to split at 4.72 Ma (95% HPD, 3.55 to 5.92 Ma), and Vcorsac/Vferrilata radiated more recently at 1.02 Ma (95% HPD, 0.51 to 1.57 Ma). The results indicated that the canids experienced rapid diversification within approximately 5.0 Myr.

Fig. 2

Estimated divergence time of Canidae species. Blue bars on nodes indicate the 95% highest probability density interval for the time estimates. Nodes are numbered, with their estimated age in Table 6.

3.4 Positive selection analysis

In the results of positive selection tests, the branch-specific models showed that the ω value in the M0 model was 0.03038. It was suggested that most mitochondrial protein genes did not undergo a positive selection. Meanwhile, our research showed that M1 models fit the data significantly bitter than the M0 models (P < 0.01), indicating that the mtDNA protein-coding genes have been subjected to different selection pressures in canids. In branch-site models, we found a positive site (2343), but it did not constitute significant evidence (P > 0.05). In the Tibetan fox, we have not found any significant positive sites in the protein-coding genes, and it indicated that there was no evidence for positive selection.

4 Discussion

Although the monophyly of fox-like canids, wolf-like canids, and South American canids was well supported in most early molecular phylogenies with gradually increasing combined data, some controversies and unresolved problems remained [17–22]. Our analyses on the basis of the nearly complete mtDNA genomes not only offers strong support for the above studies, but also clarifies the phylogenic status of Vferrilata, which has seldom been involved in the phylogenetic analyses.

The Tibetan fox is a fox endemic to the Tibetan Plateau that was once thought to be a subspecies of Vvulpes. Bininda-Emonds et al. reconstructed the phylogeny with the “matrix representation by parsimony” method and revealed that Vferrilata is more closely related to Vcorsac than to Vvulpes [39]. Our analyses elucidated the close relationship between Vferrilata and Vcorsac, and both were grouped together with Vvulpes. The placement of Vzerda basal to the fox-like clade was also in agreement with the findings of previous studies [20,22,31]. Age estimates showed that Vferrilata recently split at 1.02 Ma, which was identical to the period of rapid uplift of the Tibetan Plateau and associated habitat modification (0.9 to 1.1 Ma [40]). Moreover, the divergence time between Vzerda and other Vulpes was supported by an estimation inferred with mitochondrial genes and nuclear loci data in a previous study [22]. Nyctereutes is a highly divergent lineage that is not closely related to other canids. Phylogenetic analyses based on various data have resulted in greatly different positions for this phylogenetically problematic canid [17,20,22]. It has been nested within the South American clade in the morphological tree [41] or placed basal to other canids on the basis of molecular data [17], whereas some studies suggest a basal position to the wolf-like and South American clade [39]. Our phylogenetic analyses based on the complete mtDNA genome suggest robust support for a position basal to the fox-like clade. Our time estimation indicated that the separation of Nyctereutes from the fox happened quite early (7.63 Ma), which is in accordance with the findings of previous studies with consideration of the 95% HPD interval [22]. The East Asian canid may be related to the early canids that invaded Asia via the Beringian land bridge around 6 Ma [42].

Eleven extant species inhabit the South American continent [22], and previous studies suggested that all of these South American canids fall into a monophyletic group, with Chrysocyon located at its base. Our analyses involving Chrysocyon agreed with previous studies in finding that South American canids were strongly related to the wolf-like canids. Furthermore, the clade of Canis+Cuon was robustly supported, although other studies involving Cadustus and Cmesomelas have suggested that Canis was not monophyletic with Cuon nesting in this clade. The diversification of Chrysocyon, Canis, and Cuon occurred within approximately 4.99 Myr, which indicates the rapid evolution of Canidae. Urocyon was another phylogenetically problematic canid and the placement was uncertain in previous analyses based on different datasets [17,20,22]. In the present study, we elucidated the position of Urocyon as the basal group of all other canids. These canids involved in our study fall into these three distinct monophyletic groups, which permitted clarification of the phylogeny of these three clades with the complete mitochondrial genomes. Further studies of complete mtDNA will resolve the higher level of phylogeny and divergence among canids, especially the South American species. Recently, complete mitochondrial genomes have been shown to be more effective than partial genes in the illustration of our findings.

The mitochondrial genome encodes 13 essential oxidative phosphorylation (OXPHOS) system proteins that are necessary for oxygen usage and energy metabolism [43,44]. These 13 genes have been devoted to investigate the molecular basis of organismal adaptation to high-altitude environments [8,11,44,45]. The Tibetan fox is endemic to the Tibetan Plateau and the divergence time is identical with the period of rapid uplift of the Tibetan Plateau. However, we have not found any significant positive site in the protein-coding genes of the Tibetan fox, which indicated that there was no evidence for positive selection. This phenomenon was also found in Rhinopithecus bieti, while two residues in Rroxellana were found to be under positive selection, even though Rbieti inhabits a higher altitudinal distribution than Rroxellana [46]. The possible explanation is that the different adaptive genetic basis may exist in the Tibetan species, and it may be detected in nuclear genes. Further adaptation studies are needed to investigate the Tibetan fox nuclear genes related to energy and oxygen metabolisms.

5 Conclusions

Although phylogenetic analyses of canids based on concatenated nuclear and mitochondrial data have produced a well-resolved tree, some controversies and unresolved problems remained. We firstly attempted to use the complete mitochondrial genome data for clarifying the relative phylogenetic position of Vferrilata and other canids. Our analyses offered strong support for the above studies and elucidated the close relationship between Vferrilata and Vcorsac. Moreover, the estimation of the divergence time suggested a recent split between Vferrilata and Vcorsac, and a rapid evolution in canids. There was no genetic evidence for positive selection related to high-altitude adaption for the Tibetan fox in mtDNA and following studies should pay more attention to the detection of positive signals in nuclear genes involving in energy and oxygen metabolisms.

Disclosure of interest

The authors declare that they have no competing interest.

Acknowledgments

We would like to thank the staff of the Wildlife Park of Xining for their assistance with specimen collection. We also would like to acknowledge support from the Special Fund for Forest Scientific Research in the Public Welfare (201404420), the National Natural Science Fund of China (31372220, 31172119), the Natural Science Fund of Shandong Province of China (ZR2011CM009), and the Ph.D. Programs Foundation of Ministry of Education of China (20113705110001).


References

[1] O. Thalmann; B. Shapiro; P. Cui; V.J. Schuenemann; S.K. Sawyer; D.L. Greenfield; M.B. Germonpre; M.V. Sablin; F. Lopez-Giraldez; X. Domingo-Roura; H. Napierala; H.P. Uerpmann; D.M. Loponte; A.A. Acosta; L. Giemsch; R.W. Schmitz; B. Worthington; J.E. Buikstra; A. Druzhkova; A.S. Graphodatsky; N.D. Ovodov; N. Wahlberg; A.H. Freedman; R.M. Schweizer; K.P. Koepfli; J.A. Leonard; M. Meyer; J. Krause; S. Paabo; R.E. Green; R.K. Wayne Complete mitochondrial genomes of ancient canids suggest a European origin of domestic dogs, Science, Volume 342 (2013), pp. 871-874

[2] J.F. Pang; C. Kluetsch; X.J. Zou; A.B. Zhang; L.Y. Luo; H. Angleby; A. Ardalan; C. Ekstrom; A. Skollermo; J. Lundeberg; S. Matsumura; T. Leitner; Y.P. Zhang; P. Savolainen mtDNA data indicate a single origin for dogs south of Yangtze River, less than 16,300 years ago, from numerous wolves, Mol. Biol. Evol., Volume 26 (2009), pp. 2849-2864

[3] J.G. Inoue; M. Miya; K. Lam; B.H. Tay; J.A. Danks; J. Bell; T.I. Walker; B. Venkatesh Evolutionary origin and phylogeny of the modern holocephalans (Chondrichthyes: Chimaeriformes): a mitogenomic perspective, Mol. Biol. Evol., Volume 27 (2010), pp. 2576-2586

[4] P.A. Morin; F.I. Archer; A.D. Foote; J. Vilstrup; E.E. Allen; P. Wade; J. Durban; K. Parsons; R. Pitman; L. Li; P. Bouffard; S.C. Abel Nielsen; M. Rasmussen; E. Willerslev; M.T. Gilbert; T. Harkins Complete mitochondrial genome phylogeographic analysis of killer whales (Orcinus orca) indicates multiple species, Genome Res., Volume 20 (2010), pp. 908-916

[5] G. Liu; L. Zhou; L. Zhang; Z. Luo; W. Xu The complete mitochondrial genome of bean goose (Anser fabalis) and implications for anseriformes taxonomy, PloS one, Volume 8 (2013), p. e63334

[6] D.R. Wolstenholme Animal mitochondrial DNA: structure and evolution, Int. Rev. Cytol., Volume 141 (1992), pp. 173-216

[7] J.L. Boore Animal mitochondrial genomes, Nucleic Acids Res., Volume 27 (1999), pp. 1767-1780

[8] R.R. da Fonseca; W.E. Johnson; S.J. O’Brien; M.J. Ramos; A. Antunes The adaptive evolution of the mammalian mitochondrial genome, BMC Genomics, Volume 9 (2008), p. 119

[9] B. Li; M. Wolsan; D. Wu; W. Zhang; Y. Xu; Z. Zeng Mitochondrial genomes reveal the pattern and timing of marten (Martes), wolverine (Gulo), and fisher (Pekania) diversification, Mol. Phylogenet. Evol., Volume 80 (2014), pp. 156-164

[10] S. Matsumura; Y. Inoshima; N. Ishiguro Reconstructing the colonization history of lost wolf lineages by the analysis of the mitochondrial genome, Mol. Phylogenet. Evol., Volume 80 (2014), pp. 105-112

[11] E. Ruiz-Pesini; D. Mishmar; M. Brandon; V. Procaccio; D.C. Wallace Effects of purifying and adaptive selection on regional variation in human mtDNA, Science, Volume 303 (2004), pp. 223-226

[12] R.W. Taylor; D.M. Turnbull Mitochondrial DNA mutations in human disease, Nat. Rev. Genet., Volume 6 (2005), pp. 389-402

[13] F. Ji; M.S. Sharpley; O. Derbeneva; L.S. Alves; P. Qian; Y. Wang; D. Chalkia; M. Lvova; J. Xu; W. Yao; M. Simon; J. Platt; S. Xu; A. Angelin; A. Davila; T. Huang; P.H. Wang; L.M. Chuang; L.G. Moore; G. Qian; D.C. Wallace Mitochondrial DNA variant associated with Leber hereditary optic neuropathy and high-altitude Tibetans, Proc. Natl. Acad. Sci. USA, Volume 109 (2012), pp. 7391-7396

[14] R.M. Nowak Walker's mammals of the world, Columbia University Press, New York, 1999

[15] R.H. Tedford; B.E. Taylor; X. Wang Phylogeny of the Caninae (Carnivora: Canidae): the living taxa, Am. Mus. Novitat., Volume 0 (1995), pp. 1-37

[16] E. Geffen; M.E. Gompper; J.L. Gittleman; H.-K. Luh; D.W. Macdonald; R.K. Wayne Size, life-history traits, and social organization in the Canidae: a reevaluation, Am. Nat., Volume 147 (1996), pp. 140-160

[17] R.K. Wayne; E. Geffen; D.J. Girman; K.P. Koepfli; L.M. Lau; C.R. Marshall Molecular systematics of the Canidae, Syst. Biol., Volume 46 (1997), pp. 622-653

[18] J. Zrzavý; V. Řičánková Phylogeny of recent Canidae (Mammalia, Carnivora): relative reliability and utility of morphological and molecular datasets, Zool. Scripta, Volume 33 (2004), pp. 311-333

[19] C. Bardeleben; R.L. Moore; R.K. Wayne Isolation and molecular evolution of the selenocysteine tRNA (Cf TRSP) and RNase P RNA (Cf RPPH1) genes in the dog family, Canidae, Mol. Biol. Evol., Volume 22 (2005), pp. 347-359

[20] C. Bardeleben; R.L. Moore; R.K. Wayne A molecular phylogeny of the Canidae based on six nuclear loci, Mol. Phylogenet. Evol., Volume 37 (2005), pp. 815-831

[21] K. Lindblad-Toh; C.M. Wade; T.S. Mikkelsen; E.K. Karlsson; D.B. Jaffe; M. Kamal; M. Clamp; J.L. Chang; E.J. Kulbokas; M.C. Zody; E. Mauceli; X. Xie; M. Breen; R.K. Wayne; E.A. Ostrander; C.P. Ponting; F. Galibert; D.R. Smith; P.J. DeJong; E. Kirkness; P. Alvarez; T. Biagi; W. Brockman; J. Butler; C.W. Chin; A. Cook; J. Cuff; M.J. Daly; D. DeCaprio; S. Gnerre; M. Grabherr; M. Kellis; M. Kleber; C. Bardeleben; L. Goodstadt; A. Heger; C. Hitte; L. Kim; K.P. Koepfli; H.G. Parker; J.P. Pollinger; S.M. Searle; N.B. Sutter; R. Thomas; C. Webber; J. Baldwin; A. Abebe; A. Abouelleil; L. Aftuck; M. Ait-Zahra; T. Aldredge; N. Allen; P. An; S. Anderson; C. Antoine; H. Arachchi; A. Aslam; L. Ayotte; P. Bachantsang; A. Barry; T. Bayul; M. Benamara; A. Berlin; D. Bessette; B. Blitshteyn; T. Bloom; J. Blye; L. Boguslavskiy; C. Bonnet; B. Boukhgalter; A. Brown; P. Cahill; N. Calixte; J. Camarata; Y. Cheshatsang; J. Chu; M. Citroen; A. Collymore; P. Cooke; T. Dawoe; R. Daza; K. Decktor; S. DeGray; N. Dhargay; K. Dooley; K. Dooley; P. Dorje; K. Dorjee; L. Dorris; N. Duffey; A. Dupes; O. Egbiremolen; R. Elong; J. Falk; A. Farina; S. Faro; D. Ferguson; P. Ferreira; S. Fisher; M. FitzGerald; K. Foley; C. Foley; A. Franke; D. Friedrich; D. Gage; M. Garber; G. Gearin; G. Giannoukos; T. Goode; A. Goyette; J. Graham; E. Grandbois; K. Gyaltsen; N. Hafez; D. Hagopian; B. Hagos; J. Hall; C. Healy; R. Hegarty; T. Honan; A. Horn; N. Houde; L. Hughes; L. Hunnicutt; M. Husby; B. Jester; C. Jones; A. Kamat; B. Kanga; C. Kells; D. Khazanovich; A.C. Kieu; P. Kisner; M. Kumar; K. Lance; T. Landers; M. Lara; W. Lee; J.P. Leger; N. Lennon; L. Leuper; S. LeVine; J. Liu; X. Liu; Y. Lokyitsang; T. Lokyitsang; A. Lui; J. Macdonald; J. Major; R. Marabella; K. Maru; C. Matthews; S. McDonough; T. Mehta; J. Meldrim; A. Melnikov; L. Meneus; A. Mihalev; T. Mihova; K. Miller; R. Mittelman; V. Mlenga; L. Mulrain; G. Munson; A. Navidi; J. Naylor; T. Nguyen; N. Nguyen; C. Nguyen; T. Nguyen; R. Nicol; N. Norbu; C. Norbu; N. Novod; T. Nyima; P. Olandt; B. O’Neill; K. O’Neill; S. Osman; L. Oyono; C. Patti; D. Perrin; P. Phunkhang; F. Pierre; M. Priest; A. Rachupka; S. Raghuraman; R. Rameau; V. Ray; C. Raymond; F. Rege; C. Rise; J. Rogers; P. Rogov; J. Sahalie; S. Settipalli; T. Sharpe; T. Shea; M. Sheehan; N. Sherpa; J. Shi; D. Shih; J. Sloan; C. Smith; T. Sparrow; J. Stalker; N. Stange-Thomann; S. Stavropoulos; C. Stone; S. Stone; S. Sykes; P. Tchuinga; P. Tenzing; S. Tesfaye; D. Thoulutsang; Y. Thoulutsang; K. Topham; I. Topping; T. Tsamla; H. Vassiliev; V. Venkataraman; A. Vo; T. Wangchuk; T. Wangdi; M. Weiand; J. Wilkinson; A. Wilson; S. Yadav; S. Yang; X. Yang; G. Young; Q. Yu; J. Zainoun; L. Zembek; A. Zimmer; E.S. Lander Genome sequence, comparative analysis and haplotype structure of the domestic dog, Nature, Volume 438 (2005), pp. 803-819

[22] F.A. Perini; C.A. Russo; C.G. Schrago The evolution of South American endemic canids: a history of rapid diversification and morphological parallelism, J. Evol. Biol., Volume 23 (2010), pp. 311-322

[23] G.J. Slater; O. Thalmann; J.A. Leonard; R.M. Schweizer; K.P. Koepfli; J.P. Pollinger; N.J. Rawlence; J.J. Austin; A. Cooper; R.K. Wayne Evolutionary history of the Falklands wolf, Curr. Biol., Volume 19 (2009), p. R937-R938

[24] D.K. Sharma; J.E. Maldonado; Y.V. Jhala; R.C. Fleischer Ancient wolf lineages in India, Proc. R. Soc. Lond. B Biol. Sci., Volume 271 (2004) no. Suppl. 3, p. S1-S4

[25] W. Zhang; Z. Fan; E. Han; R. Hou; L. Zhang; M. Galaverni; J. Huang; H. Liu; P. Silva; P. Li; J.P. Pollinger; L. Du; X. Zhang; B. Yue; R.K. Wayne; Z. Zhang Hypoxia adaptations in the grey wolf (Canis lupus chanco) from Qinghai–Tibet Plateau, PLoS Genet., Volume 10 (2014), p. e1004466

[26] A.W. Briggs; J.M. Good; R.E. Green; J. Krause; T. Maricic; U. Stenzel; C. Lalueza-Fox; P. Rudan; D. Brajkovic; Z. Kucan; I. Gusic; R. Schmitz; V.B. Doronichev; L.V. Golovanova; M. de la Rasilla; J. Fortea; A. Rosas; S. Paabo Targeted retrieval and analysis of five Neandertal mtDNA genomes, Science, Volume 325 (2009), pp. 318-321

[27] B.J. Knaus; R. Cronn; A. Liston; K. Pilgrim; M.K. Schwartz Mitochondrial genome sequences illuminate maternal lineages of conservation concern in a rare carnivore, BMC Ecol., Volume 11 (2011), p. 10

[28] P.K. Sahoo; C. Goel; R. Kumar; N. Dhama; S. Ali; D. Sarma; P. Nanda; A. Barat The complete mitochondrial genome of threatened chocolate mahseer (Neolissochilus hexagonolepis) and its phylogeny, Gene, Volume 570 (2015) no. 2, pp. 299-303

[29] E. Haring; L. Kruckenhauser; A. Gamauf; M.J. Riesing; W. Pinsker The complete sequence of the mitochondrial genome of Buteo buteo (Aves, Accipitridae) indicates an early split in the phylogeny of raptors, Mol. Biol. Evol., Volume 18 (2001), pp. 1892-1904

[30] H.O. Clark; D.P. Newman; J.D. Murdoch; J. Tseng; Z.H. Wang; R.B. Harris Vulpes Ferrilata (Carnivora: Canidae), Mammalian Species, Volume 821 (2008), pp. 1-6

[31] E. Geffen; A. Mercure; D.J. Girman; D.W. Macdonald; R.K. Wayne Phylogenetic relationships of the fox-like canids: mitochondrial DNA restriction fragment, site and cytochromebsequence analyses, J. Zool., Volume 228 (1992), pp. 27-39

[32] W. Jiang; X. Wang; M. Li; Z. Wang Identification of the Tibetan fox (Vulpes ferrilata) and the red fox (Vulpes vulpes) by copro-DNA diagnosis, Mol. Ecol. Resour., Volume 11 (2011), pp. 206-210

[33] K. Tamura; J. Dudley; M. Nei; S. Kumar MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0, Mol. Biol. Evol., Volume 24 (2007), pp. 1596-1599

[34] D. Posada; K.A. Crandall MODELTEST: testing the model of DNA substitution, Bioinformatics, Volume 14 (1998), pp. 817-818

[35] F. Ronquist; J.P. Huelsenbeck MrBayes 3: Bayesian phylogenetic inference under mixed models, Bioinformatics, Volume 19 (2003), pp. 1572-1574

[36] A.J. Drummond; A. Rambaut BEAST: Bayesian evolutionary analysis by sampling trees, BMC Evol. Biol., Volume 7 (2007), p. 214

[37] U. Arnason; A. Gullberg; A. Janke; M. Kullberg Mitogenomic analyses of caniform relationships, Mol. Phylogenet. Evol., Volume 45 (2007), pp. 863-874

[38] T.W. Quinn; A.C. Wilson Sequence evolution in and around the mitochondrial control region in birds, J. Mol. Evol., Volume 37 (1993), pp. 417-425

[39] O.R. Bininda-Emonds; J.L. Gittleman; A. Purvis Building large trees by combining phylogenetic information: a complete phylogeny of the extant Carnivora (Mammalia), Biol. Rev. Camb. Philos. Soc., Volume 74 (1999), pp. 143-175

[40] J. Sun; T. Liu Stratigraphic evidence for the uplift of the Tibetan Plateau between ∼1.1 and ∼0.9 myr ago, Quaternary Res., Volume 54 (2000), pp. 309-320

[41] A. Berta Origin, diversification and, zoogeography of the South American Canidae, Fieldiana Zool., Volume 39 (1987), pp. 455-471

[42] X. Wang; R.H. Tedford; M. Antón Dogs: Their Fossil Relatives and Evolutionary History, Columbia University Press, New York, 2010

[43] Y. Luo; W. Gao; Y. Gao; S. Tang; Q. Huang; X. Tan; J. Chen; T. Huang Mitochondrial genome analysis of Ochotona curzoniae and implication of cytochrome c oxidase in hypoxic adaptation, Mitochondrion, Volume 8 (2008), pp. 352-357

[44] S. Xu; J. Luosang; S. Hua; J. He; A. Ciren; W. Wang; X. Tong; Y. Liang; J. Wang; X. Zheng High altitude adaptation and phylogenetic analysis of Tibetan horse based on the mitochondrial genome, J. Genet. Genomics, Volume 34 (2007), pp. 720-729

[45] D. Mishmar; E. Ruiz-Pesini; P. Golik; V. Macaulay; A.G. Clark; S. Hosseini; M. Brandon; K. Easley; E. Chen; M.D. Brown; R.I. Sukernik; A. Olckers; D.C. Wallace Natural selection shaped regional mtDNA variation in humans, Proc. Natl. Acad. Sci. USA, Volume 100 (2003), pp. 171-176

[46] L. Yu; X. Wang; N. Ting; Y. Zhang Mitogenomic analysis of Chinese snub-nosed monkeys: Evidence of positive selection in NADH dehydrogenase genes in high-altitude adaptation, Mitochondrion, Volume 11 (2011), pp. 497-503


Comments - Policy