Outline
Comptes Rendus

Biodiversity/Biodiversité
New case of lateral asymmetry in fishes: A new subfamily, genus and species of deep water clingfishes from Papua New Guinea, western Pacific Ocean
Comptes Rendus. Biologies, Volume 340 (2017) no. 1, pp. 47-62

Abstracts

The unusual clingfish Protogobiesox asymmetricus n. gen, n. sp. is described on the basis of four specimens collected in deep water off the north coast of Papua New Guinea in 2012. The species is characterized by its 9–10 dorsal rays, 8 anal rays, 17–24 pectoral-fin rays, 15 principal caudal-fin rays, 3 gills, third arch with 3 gill rakers, 34–35 total vertebrae, with asymmetrical lateral bending starting behind the skull, bent at an angle of 85°–92°; skull asymmetrical in frontal view; skin naked, surface of head and body without striae; disc without adhesive papillae. A new subfamily Protogobiesocinae is described for this species and Lepadicyathus mendeleevi Prokofiev, 2005, which is redescribed. The new subfamily is compared within the family; keys to the subfamilies of Gobiesocidae and the species within the new subfamily are presented; its phylogenetic relationship to other gobiesocids is inferred based on a multi-locus DNA dataset.

Le porte-écuelle insolite Protogobiesox asymmetricus n. gen, n. sp. est décrit à partir de quatre spécimens collectés en 2012 dans les eaux profondes au large de la côte nord de la Papouasie-Nouvelle-Guinée. L’espèce se caractérise par sa nageoire dorsale avec 9–10 rayons, sa nageoire anale avec 8 rayons, sa nageoire pectorale avec 17–24 rayons, 15 rayons principaux sur la nageoire caudale, 3 branchies, un troisième arc branchial avec 3 branchiospines, une colonne vertébrale avec un total de 34–35 vertèbres, le corps arrière du crâne présentant une pré-asymétrie latérale et plié à un angle de 85°–92, un crâne asymétrique en vue de face, une peau nue, une surface de tête et un corps sans stries, un disque sans papille adhésive. Une nouvelle sous-famille, les Protogobiesocinae, est décrite pour cette espèce, et Lepadicyathus mendeleevi Prokofiev 2005 est décrit à nouveau. La nouvelle sous-famille est comparée aux autres membres de la famille; des clés pour les sous-familles de Gobiesocidae et les espèces incluses dans cette nouvelle sous-famille sont présentées ; sa relation de parenté au sein des gobiesocidés est inférée à partir d’un jeu de données ADN multi-locus.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2016.11.002
Keywords: Gobiesocidae, Clingfishes, New subfamily, New genus, New species, Papua New Guinea, Molecular phylogeny, PAPUA NIUGINI biodiversity expedition
Mots-clés : Gobiesocidé, Porte-écuelles, Nouvelle sous-famille, Nouveau genre, Nouvelle espèce, Papouasie-Nouvelle-Guinée, Phylogénie moléculaire, Expédition biodiversité PAPUA NIUGINI

Ronald Fricke  1 ; Jhen-Nien Chen  2 ; Wei-Jen Chen  2

1 Im Ramstal 76, 97922 Lauda-Königshofen, Germany
2 Institute of Oceanography, National Taiwan University, No. 1 Sec. 4, Roosevelt Road, 10617 Taipei, Taiwan
Ronald Fricke; Jhen-Nien Chen; Wei-Jen Chen. New case of lateral asymmetry in fishes: A new subfamily, genus and species of deep water clingfishes from Papua New Guinea, western Pacific Ocean. Comptes Rendus. Biologies, Volume 340 (2017) no. 1, pp. 47-62. doi: 10.1016/j.crvi.2016.11.002
@article{CRBIOL_2017__340_1_47_0,
     author = {Ronald Fricke and Jhen-Nien Chen and Wei-Jen Chen},
     title = {New case of lateral asymmetry in fishes: {A} new subfamily, genus and species of deep water clingfishes from {Papua} {New} {Guinea,} western {Pacific} {Ocean}},
     journal = {Comptes Rendus. Biologies},
     pages = {47--62},
     year = {2017},
     publisher = {Elsevier},
     volume = {340},
     number = {1},
     doi = {10.1016/j.crvi.2016.11.002},
     language = {en},
}
TY  - JOUR
AU  - Ronald Fricke
AU  - Jhen-Nien Chen
AU  - Wei-Jen Chen
TI  - New case of lateral asymmetry in fishes: A new subfamily, genus and species of deep water clingfishes from Papua New Guinea, western Pacific Ocean
JO  - Comptes Rendus. Biologies
PY  - 2017
SP  - 47
EP  - 62
VL  - 340
IS  - 1
PB  - Elsevier
DO  - 10.1016/j.crvi.2016.11.002
LA  - en
ID  - CRBIOL_2017__340_1_47_0
ER  - 
%0 Journal Article
%A Ronald Fricke
%A Jhen-Nien Chen
%A Wei-Jen Chen
%T New case of lateral asymmetry in fishes: A new subfamily, genus and species of deep water clingfishes from Papua New Guinea, western Pacific Ocean
%J Comptes Rendus. Biologies
%D 2017
%P 47-62
%V 340
%N 1
%I Elsevier
%R 10.1016/j.crvi.2016.11.002
%G en
%F CRBIOL_2017__340_1_47_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

The clingfishes of the family Gobiesocidae are predominantly marine fishes distributed worldwide in tropical and temperate seas, with only eight species of the genus Gobiesox Lacepède 1800 living in freshwater streams of the tropics. They occur on hard substrata, usually on rocky bottom or in coral reefs, mostly in shallow waters, but some live on the continental or insular shelf down to 337 m (Kopua nuimata Hardy 1984 from New Zealand; see Hardy [1]; Hutchins [2]). Clingfishes are small in body size (usually less than 50 mm in total length), characterized by an adhesive disc formed by the pelvic fins, the head depressed, the skin naked, one dorsal and anal fin each, and several specialized osteological characters. The family was revised by Briggs [3], who distinguished 30 genera and 85 species, with some divided in several subspecies. Springer & Fraser [4] examined the osteology of the species in the enigmatic perciform family Cheilobranchidae, and assigned its members (arranged in a single genus Alabes Cloquet 1816) to the Gobiesocidae. The following genera and species were described subsequently to the revisions of Briggs [3] and Springer & Fraser [4]: Lecanogaster, L. chrysea and Opeatogenys cadenati by Briggs [5], Aspasmodes and A. briggsi by Smith [6], Gobiesox marijeanae by Briggs [7], Gobiesox fluviatilis and G. mexicanus by Briggs & Miller [8], Lepadichthys bolini by Briggs [9], Gobiesox lucayanus by Briggs [10], Lepadichthys ctenion and L. erythraeus by Briggs & Link [11], Diplecogaster bimaculata euxinica by Murgoci [12], Apletodon knysnaensis by Smith [13] (synonym of A. pellegrini according to Briggs [14]), Lepadichthys lineatus by Briggs [15], Lissonanchus and L. lusheri by Smith [16], Tomicodon prodomus by Briggs [17], Derilissus and D. nanus by Briggs [18], Lepadichthys caritus by Briggs [19], Arcos decoris, Rimicola brevis and Tomicodon bidens by Briggs [20], Tomicodon rhabdotus by Smith-Vaniz [21], Gymnoscyphus and G. ascitus by Böhlke & Robins [22], Derilissus kremnobates and D. vittiger by Fraser [23], Derilissus altifrons by Smith-Vaniz [24], Discotrema and D. crinophilum by Briggs [25] as D. crinophila), Modicus, M. minimus and M. tangaroa by Hardy [26], Cochleoceps bassensis by Hutchins [27], Propherallodus, P. briggsi, Pherallodichthys and P. meshimaensis by Shiogaki & Dotsu [28], Kopua and K. nuimata by Hardy [29], Aspasmogaster occidentalis by Hutchins [30], Tomicodon abuelorum by Szelistowski [31], Kopua kuiteri by Hutchins [2], Cochleoceps viridis, C. bicolor and C. orientalis by Hutchins [32], Posidonichthys and P. hutchinsi by Briggs [33], Gobiesox juniperoserrai by Espinosa et al. [34], Apletodon incognitus by Hofrichter & Patzner [35], Lepadichthys springeri by Briggs [36], Tomicodon reitzae by Briggs [37], Rimicola cabrilloi by Briggs [38], Tomicodon briggsi, T. clarkei, T. cryptus, T. lavettsmithi and T. leurodiscus by Williams & Tyler [39], Alabes elongata, A. gibbosa, A. obtusirostris, A. occidentalis and A. scotti by Hutchins & Morrison [40], Acyrtus pauciradiatus by Sampaio et al. [41], Lepadicyathus and L. mendeleevi by Prokofiev [42], Alabes bathys and A. springeri by Hutchins [43], Apletodon wirtzi by Fricke [44], Discotrema monogrammum and D. zonatum by Craig & Randall [45], Briggsia and B. hastingsi by Craig & Randall [46], Apletodon barbatus by Fricke et al. [47], Aspasmichthys alorensis and Lepadichthys akiko by Allen & Erdmann [48], Kopua japonica by Moore et al. [49], Derilissus lombardii by Sparks & Gruber [50], Acyrtus lanthanum by Conway et al. [51], Unguitrema and U. nigrum by Fricke [52], Diplecogaster tonstricula by Fricke et al. [53], Kopua vermiculata by Shinohara & Katayama [54], and Lepadichthys bilineatus by Craig, Bogorodsky & Randall in Craig et al. [55].

At present, 166 species belonging to 48 genera of gobiesocids are recognized; they are currently classified into nine subfamilies (Briggs [3]; Conway et al. [56]): Aspasminae Briggs 1955, Cheilobranchinae Günther 1870, Chorisochisminae Briggs 1955, Diademichtyinae Whitley 1950, Diplocrepinae Briggs 1955, Gobiesocinae Bleeker 1859, Haplocyclicinae Briggs 1955, Lepadogastrinae Canestrini 1871–1872, Trachelochisminae Briggs 1955. A list of a generic classification within these subfamilies was provided by Conway et al. [56].

During the PAPUA NIUGINI Biodiversity Expedition in 2012, specimens of an unusual, laterally asymmetrical clingfish were collected in deep water off the north-eastern coast of Papua New Guinea. They were compared with the other known gobiesocid species and other taxa in gobiesocid-related fish families, and were found to represent an undescribed subfamily, genus and species of gobiesocid fishes, which is described in the present paper. In addition, the genus Lepadicyathus Prokofiev 2005, which is currently classified in the Aspasminae, is revised; the only known species, Lepadicyathus mendeleevi Prokofiev 2005, is redescribed.

2 Methods and materials

Our descriptive methods follow Briggs [3] and Fricke et al. [57]. Sex determination based on the presence or the absence of urogenital papillae is confirmed by internal examination (gonads). The abbreviation “SL” refers to the standard length (measured from the tip of the snout to the middle of the caudal fin base), “TL” to the total length (measured from the tip of the snout to the end of the caudal fin). The adhesive disc is divided into three different areas: region A is the anterior portion, region B is the posterior one, and region C is the centre of the disc (as illustrated by Briggs [3]). In the description of new taxa, data of the holotype are given first, followed by data of the paratypes in parentheses. Fin rays are counted using the method of Fricke (1983), where spines are expressed as Roman numerals, unbranched soft rays are expressed as lower-case Roman numerals, and branched rays as Arabic numerals. Authors and dates of family-group taxa follow Laan et al. [58]. The updated key to subfamilies of Gobiesocidae is based on Briggs [3]. To elucidate the relationships of the unusual clingfish discovered in this study and to assign it to its proper higher hierarchic taxonomic rank, its multi-locus DNA sequences were generated and compared to those obtained from the representative taxa in the Gobiesocidae and other gobiesocid-related families determined by previous studies investigating acanthomorph phylogeny (Chen et al. [59,60]; Dettaï & Lecointre [61]; Near et al. [62]). The list of taxa used for the molecular analysis in this study was provided in Table 1. The collection of new molecular data was carried out by the following procedures. Small pieces of muscle or fin tissue were excised from the specimens, preserved in 95% ethanol, and stored at −20 °C in the Marine Biodiversity and Phylogenomics Laboratory at the Institute of Oceanography, National Taiwan University (NTU), Taipei. Genomic DNA was extracted using an automated DNA-extractor 199 (LabTurbo 48 Compact System with LGD 480–220 kits: Taigene 200 Bioscience Corporation, Taipei) following the manufacturer's 201 protocol. The polymerase chain reaction (PCR) was used to amplify the following targeting gene fragments: recombination activating gene 1 (RAG1), rhodopsin (RH), early growth response 2B (EGR2B), cytochrome oxidase subunit I (COI), 12S and 16S ribosomal RNAs (12S and 16S). The first three are encoded in the nuclear genome and the remaining three are part of the mitochondrial genome. These genes were selected for their ability to provide sound phylogenetic information for inter- and intra-familiar relationships in several previous phylogenetic studies focusing on the percomorph fishes (e.g., Chen et al. [60]; Lo et al. [63]). Primer sequences in this study are listed in Table 2. Temperature cycling profiles for amplification consisted of an initial denaturation stage (95 °C, 5 min) followed by 35 cycles, each with a denaturation step (95 °C, 40 s), an annealing step (53 °C for RAG1 and EGR2B; 55 °C for the other genes, 40 s) and an elongation step (72 °C, 90 s for RAG1 and 60 s for the other genes), before a final extension stage (72 °C, 7 min). PCR products were purified using the AMPure magnetic bead clean-up protocol (Agencourt Bioscience Corp., USA). Purified PCR products were sequenced by Sanger sequencing using dye-labelled terminators. Sequence determinations from Sanger reaction products were generated on ABI 3730 analyzers (Applied Biosystems, USA) at Genomics BioSci & Tech (Taipei) and at the Center of Biotechnology (National Taiwan University). For each locus and specimen, the chromatograms of the sequences were checked and edited manually using the program CodonCode Aligner 3.7.2.2 (Codoncode Corporation, Dedham, MA, USA). Chromatograms were examined for evidence of sequencing artefacts or problematic base calls. Verified complementary chromatograms were then assembled to build consensus sequences. All sequences from the orthologous gene were aligned using the automatic multiple-alignment program Muscle (Edgar [64]). The resulting multiple sequence alignments were adjusted by eye using the inferred amino acid translation as a guide for inferred gap placement in protein coding genes and the loop/stem structure of 12S and 16S ribosomal RNAs to identify loop regions where site homology was difficult to ascertain with confidence. Alignments were edited using Se-Al v2.0a11 (Rambaut [65]). Short regions of the alignments from EGR2B, 12S and 16S in which homology assessment is uncertain were excluded from the further steps of phylogenetic analysis. Phylogenetic analysis was conducted based on the combined data matrix complied from the aligned DNA sequences from the six genes with a partitioned maximum likelihood (ML) method as implemented in the parallel version of RAxML 7.4.2 (Stamatakis [66]). A mixed-model analysis was used that allows the independent estimation of individual models of nucleotide substitution for each partition. Three partitions (by codon) were assigned for cytochrome b and rhodopsin. Fourteen partitions (by gene and by codon position of protein coding gene) were assigned. Because RAxML only provides GTR-related (Yang [67]) models of rate heterogeneity for nucleotide data (Stamatakis [66]), the nucleotide substitution model GTR + Γ+I was employed for the analysis. Optimal ML tree search was conducted with 100 separate runs using the default algorithm of the program for each run and the final tree with the best ML score was selected among the 100 ML trees of these runs. Finally, nodal support was assessed with bootstrapping (BS) (Felsenstein [68]) with the maximum likelihood (ML) criterion, based on 500 pseudo-replicates. The inferred phylogenetic tree was rooted by two non-“Ovalentaria” taxa: Hippoglossus stenolepis (Pleuronectidae) and Parastromateus niger (Carangidae). The specimens cited in the present paper are deposited in the following collections: AMS, The Australian Museum, Sydney, Australia; MNHN, “Muséum national d’histoire naturelle”, Paris, France; NTUM, National Taiwan University Museums, Taipei, Taiwan; ZIN, Laboratory of Ichthyology, Zoological Institute, Russian Academy of Sciences, St. Petersburg, Russia. The abbreviations of repositories of additional materials follow Fricke & Eschmeyer [69].

Table 1

Taxa, genes, and Genbank accession numbers for the gene sequences of representative species.

Table 1
Taxon GenBank accession no.
Tissue ID Voucher RAG1 Rhodopsin EGR2B COI 12S 16S
Pleuronectidae a
Hippoglossus stenolepis Schmidt 1904 WJC148 NA KF311999 KF312141 KF312079 AM749128 AM749128 AM749128
Carangidae a
Parastromateus niger (Bloch 1795) WJC11 NA EF095654 EF095616 KC442131 KC442079 EF095562 EF095590
Embiotocidae
Ditrema temminckii Bleeker 1853 WJC171 NA KY126055 KY126046 KY126033 AP009129 AP009129 AP009129
Mugilidae
Liza aurata (Risso 1810) WJC18 NA KF017112 KF017144 KF017049 JQ060457 EU715447 GQ252691
Pomacentridae
Dascyllus aruanus (Linnaeus 1758) WJC377 NA EF095674 EF095632 KY126034 KJ968020 AF081228 AF119402
Cichlidae
Astronotus ocellatus (Agassiz 1831) WJC168 NA EF095671 EF095629 JN231060 KC442077 EF095575 EF095603
Ambassidae
Parambassis wolffii (Bleeker 1850) WJC49 NA EF095647 EF095612 KY126035 EF095558 EF095586
Bedotiidae
Bedotia geayi Pellegrin 1907 WJC399 NA EF095640 AY141267 KC442117 AY290799 AY141339 AY141409
Adrianichthyidae
Oryzias latipes (Temminck & Schlegel 1846) NA NA EF095641 AB001606 AP004421 EF095555 EF095583
Clinidae
Heterostichus rostratus Girard 1854 WJC118 SIO 01-179 HQ168866 HQ168988 KY126036 HQ168631 HQ158801 AY822076
Labrisomidae
Labrisomus nuchipinnis (Quoy & Gaimard 1824) WJC86 NA KY126056 KY126047 KY126037 KF930015 AY098808 AY098848
Gobiesocidae
 Aspasminae
  Aspasma minima (Döderlein 1887) EU637943 NC_008130 NC_008130 NC_008130
Cheilobranchinae
  Alabes hoesei Springer & Fraser 1976 WJC5173 I.45630-050 KY126057 KY126038 KY126065 KY126072 KY126080
  Alabes scotti Hutchins & Morrison 2004 WJC5174 I.46305-001 KY126058 KY126048 KY126039 KY126066 KY126073 KY126081
Diademichthyinae
  Lepadichthys lineatus Briggs 1966 WJC5008 14-1309 Dili KY126059 KY126049 KY126040 KY126067 KY126074 KY126082
Gobiesocinae
  Acyrtus lanthanum Conway, Baldwin & White 2014 WJC5006 01-033-Arsp KY126060 KY126050 KY126041 KY126068 KY126075 KY126083
  Gobiesox strumosus Cope 1870 WJC65 NA KY126061 KY126051 KY126042 KY126069 KY126076 KY126084
  Acyrtops beryllinus (Hildebrand & Ginsburg 1927) WJC82 NA KY126062 KY126052 KY126043 KY126070 KY126077 KY126085
  Tomicodon humeralis (Gilbert 1890) SIO 02-1-1 HQ168876 HQ169001 HQ168639
Lepadogastrinae
  Apletodon dentatus (Facciolà 1887) WJC305 NA KY126063 KY126053 KY126044 KJ616456 KY126078 KY126086
  Lepadogaster lepadogaster (Bonnaterre 1788) AY141273 KF369136 AY141347 AY141417
Protogobiesocinae
  Protogobiesox asymmetricus n. sp. PNG1169 NTUM10633 KY126064 KY126054 KY126045 KY126071 KY126079 KY126087

a Outgroups used for rooting the inferred phylogenetic tree.

Table 2

Primers used in this study.

Table 2
Locus/Primera Primer sequences (5′-3′) Source
RGA1 R1 2533F CTGAGCTGCAGTCAGTACCATAAGATGT López et al., 2004
R1 4078R TGAGCCTCCATGAACTTCTGAAGRTAYTT López et al., 2004
R1 4061R AATACTTGGAGGTGTAGAGCCAGT Chen et al., 2007
R1 4090R CTGAGTCCTTGTGAGCTTCCATRAAYTT López et al., 2004
EGR2B E2B 252F CGCAACCAGACTTTCACCTAY Chen et al., 2013
E2B 261F TTCACCTAYATGGGNAAGTTCTCMAT Chen et al., 2013
E2B 270F ATGGGRAAGTTCTCCATCGAC Chen et al., 2013
E2B 278F AGTTTTCCATCGACTCSCAGTA Chen et al., 2008
E2B 287F TTGACTCSCAGTATCCAGGTAAC Chen et al., 2008
E2B 1078R AATTTGCGNCCGCAGSAGTC Chen et al., 2013
E2B 1078R-bis GAACTTACGNCCGCAGAARTC Chen et al., 2013
E2B 1108R TTTTGTGTGTCTCTTTCTYTCGTC Chen et al., 2008
E2B 1112R ATTTTNGTGTGTCGYTTYCTC Chen et al., 2013
E2B 1117R AGGTGGATTTTGGTGTGTCTYTT Chen et al., 2008
E2B 1121R CCTCAGGTGGATTTTAGTGTGTC Chen et al., 2013
Rhosopsin RH 1F ATGAACGGCACAGARGGAC Chen et al., 2003
RH 193F CNTATGAATAYCCTCAGTACTACC Chen et al.
RH 1039R TGCTTGTTCATGCAGATGTAGA Chen et al.
COI CoxI_FishF1 TCAACCAACCACAAAGACATTGGCAC Ward et al., 2005
CoxI_FishF2 TCGACTAATCATAAAGATATCGGCAC Ward et al., 2005
CoxI_FishR1 TAGACTTCTGGGTGGCCAAAGAATCA Ward et al., 2005
CoxI_FishR2 ACTTCAGGGTGACCGAAGAATCAGAA Ward et al., 2005
12S L1090 AAAGCACGGCACTGAAGATGC Palumbi et al., 1991
H1478 TTTCATGTTTCCTTGCGGTAC Palumbi et al., 1991
16S arL CGCCTGTTTAACAAAAACAT Palumbi et al., 1991
brH CCGGTCTGAACTCAGATCAGT Palumbi et al., 1991

a Reverse primers in italics

2.1 Comparative material for morphological examination

Acyrtops amplicirrus: CAS-SU 18101 (2 paratypes), St. Thomas, Virgin Islands. Acyrtus artius: CAS-SU 23254 (holotype), Curaçao, Netherlands West Indies; CAS-SU 47942 (1 paratype), Curaçao, Netherlands West Indies. Alabes dorsalis: SMNS 1694 (4), Murray River estuary, South Australia; SMNS 21395 (1), Cape Dromedary, New South Wales, Australia. Apletodon barbatus: SMNS 26427 (holotype), São Tiago Island, Cape Verde Islands; MNHN 2009-1592 (1 paratype), same data as the holotype; SMNS 24604 (1), Sal Island, Cape Verde Islands; SMNS 24605 (1), Sal Island, Cape Verde Islands; SMNS 26428 (19 paratypes), same data as the holotype; USNM 396967 (1 paratype), same data as the holotype. A. dentatus: CCML uncat. (2), Alegranza Island, Canary Islands; CCML uncat. (2), Lanzarote Island, Canary Islands; SMNS 12664 (1), Genoa, Italy. A. incognitus: NMW 93029 (holotype), Banyuls-sur-Mer, France; CCML uncat. (2), Gran Canaria, Canary Islands; CCML uncat. (1), La Graciosa, Canary Islands; SMNS 21814 (1), Faial, Azores Islands. A. pellegrini: SAIAB 10255 (1), Knysna, South Africa; SAIAB 10852 (11), Knysna, South Africa; SAIAB 14599 (7), South Africa; SAIAB 43756 (5), False Bay, South Africa; USNM 198169 (1 paratype), Knysna, South Africa; USNM 270272 (1), Algoa Bay, South Africa. A. wirtzi: SMNS 24130 (holotype), Bombom Island, São Tomé and Principe; MNHN 2005-0170 (1 paratype), same data as the holotype; SMNS 24446 (5 paratypes), same data as the holotype; SMNS 24132 (2 paratypes), same data as the holotype; SMNS 25472 (5), Limbe, Cameroon; USNM 381374 (1 paratype), same data as the holotype. Arcos nudus: SMNS 11301 (4), Rio San Juan, Dominican Republic; SMNS 11401 (12), Rio Baonico, Dominican Republic; SMNS 11408 (3), Rio Nazaito, Dominican Republic. Aspasma minima: NMW 76995 (2 syntypes), Sagami Bay, Japan. Aspasmichthys ciconiae: CAS-SU 7136 (1 syntype), Inland Sea, Japan; USNM 50760 (1 syntype), Inland Sea, Japan. Aspasmogaster costata: SMNS 14754 (9), Red Head, New South Wales, Australia. Chorisochismus dentex: USNM 119223 (1), Algoa Bay, South Africa. Cochleoceps spatula: SMNS 12519 (1), Cervantes Island, Western Australia. Conidens laticephalus: SMNS 24701 (10), Northeast Cape, Taiwan. C. samoensis: SMNS 21982 (1), Province Sud, Grande Terre, New Caledonia; SMNS 22836 (3), Province Sud, Grande Terre, New Caledonia. Creocele cardinalis: SMNS 14806 (1), Tasmania, Australia. Dellichthys morelandi: SMNS 13754 (5), North Island, New Zealand; SMNS 13762 (1), North Island, New Zealand; SMNS 13780 (4), North Island, New Zealand; SMNS 13827 (1), North Island, New Zealand; SMNS 14142 (4), North Island, New Zealand. Derilissus altifrons: ANSP 112690 (holotype), Dominica. D. vittiger: ANSP 109626 (holotype), Venezuela. Diademichthys lineatus: SMNS 18156 (2), Fiji, Viti Levu; SMNS 21975 (3), New Caledonia, Récif Goëland; SMNS 21977 (1), New Caledonia, Nouméa; SMNS 21979 (2), New Caledonia, Baie Maá; SMNS 21980 (2), New Caledonia, Bancs Nord; SMNS 22995 (1), New Caledonia, Baie de Pritzbue; SMNS 23522 (1), New Caledonia, Nouméa; SMNS 23997 (1), New Caledonia, Nouméa; SMNS 25414 (1), New Caledonia, Nouméa; SMNS 26545 (1), New Caledonia, Baie de Goro. Diplecogaster bimaculata: HUJ 20577 (7), Balearic Islands, S Mallorca; HUJ 20593 (1), Balearic Islands, NE Mallorca; HUJ 20602 (2), Balearic Islands, NW Mallorca; HUJ 20623 (1), Balearic Islands, SSE Mallorca; SMNS 12541 (1), Pyrenées Orientales, France; SMNS 13177 (1), Giglio Island, Italy; SMNS 14049 (2), Giglio Island, Italy; SMNS 19061 (2), Karavas Alsavcak Bay, Northern Cyprus; SMNS 19204 (2), Giglio Island, Italy; SMNS 20163 (8), Caniço de Baixo, Madeira; SMNS 20347 (1), Tabarca, Tunisia; SMNS 21202 (2), Porto Novo, Madeira. D. ctenocrypta: ZMUC P9037 (holotype), Gran Canaria, Canary Islands. D. pectoralis: SMNS 11916 (4), Faial Island, Azores Islands. D. tonstricula: ZSM 40089 (holotype), Dakar, Senegal; CCML uncat. (2 paratypes), Fuerteventura, Canary Islands; ZSM uncat. (5 paratypes), Dakar, Senegal. Diplocrepis puniceus: SMNS 10012 (2), North Island, New Zealand; SMNS 13755 (2), North Island, New Zealand; SMNS 13769 (1), North Island, New Zealand; SMNS 13782 (1), North Island, New Zealand; SMNS 13828 (8), North Island, New Zealand; SMNS 13832 (4), North Island, New Zealand; SMNS 13922 (42), South Island, New Zealand; SMNS 13936 (32), South Island, New Zealand; SMNS 13945 (24), South Island, New Zealand; SMNS 14003 (1), South Island, New Zealand; SMNS 14043 (1), South Island, New Zealand; SMNS 14069 (1), South Island, New Zealand. Discotrema crinophilum: SMNS 16677 (1), Philippines, Balicasag Island; SMNS 16678 (1), Philippines, Balicasag Island; SMNS 17896 (1), Society Islands, Moorea (new record); SMNS 21981 (1), New Caledonia, Nouméa. D. monogrammum: BPBM 39040 (holotype), Papua New Guinea, New Britain; BPBM 36504 (2), Indonesia, Flores. D. zonatum: BPBM 38972 (holotype), Fiji, Charybdis Reef. Gastrocyathus gracilis: SMNS 10011 (1), North Island, New Zealand; SMNS 14124 (1), North Island, New Zealand. Gastroscyphus hectoris: SMNS 13763 (1), North Island, New Zealand; SMNS 13770 (1), North Island, New Zealand; SMNS 13829 (3), North Island, New Zealand; SMNS 13834 (27), North Island, New Zealand; SMNS 13854 (1), North Island, New Zealand; SMNS 13862 (1), North Island, New Zealand; SMNS 13923 (26), South Island, New Zealand; SMNS 13924 (76), South Island, New Zealand; SMNS 13938 (6), South Island, New Zealand; SMNS 13947(9), South Island, New Zealand; SMNS 13948 (17), South Island, New Zealand; SMNS 13949 (30), South Island, New Zealand; SMNS 14008 (5), South Island, New Zealand; SMNS 14018 (1), South Island, New Zealand. Gobiesox strumosus: SMNS 13612 (1), Rio de Janeiro, Brazil. Gouania willdenowi: SMNS 421 (4), Hvar Island, Croatia; SMNS 576 (2), Hvar Island, Croatia; SMNS 13175 (1), Giglio Island, Italy; SMNS 13573 (1), Costa Brava, Spain; SMNS 13574 (1), Crete Island, Greece; SMNS 16808 (6), Sicily, Italy; SMNS 22064 (6), Cres Island, Croatia. Gymnoscyphus ascitus: ANSP 113587 (holotype), St. Vincent. Haplocylix littoreus: CAS-SU 47678 (2), North Island, New Zealand. Kopua nuimata: SMNS 10013 (1), North Island, New Zealand; SMNS 13737 (6), North Island, New Zealand; SMNS 13781 (1), North Island, New Zealand; SMNS 13826 (22), North Island, New Zealand; SMNS 13833 (2), North Island, New Zealand; SMNS 13943 (4), South Island, New Zealand; SMNS 13996 (20), South Island, New Zealand; SMNS 14030 (1), South Island, New Zealand; SMNS 14042 (2), Stewart Island, New Zealand; SMNS 14070 (1), South Island, New Zealand; SMNS 14127 (1), South Island, New Zealand; SMNS 14151 (2), South Island, New Zealand. Lecanogaster chrysea: BMNH 1958.7.3.1 (holotype), Lingo, Ghana. Lepadichthys caritus: BPBM 34140 (1), Indonesia, Flores. L. coccinotaenia: BPBM 21711 (1), South Africa, KwaZulu-Natal. L. erythraeus: SMNS 22550 (1), Red Sea, Gulf of Aqaba, Egypt, 14 km north of Nuweiba. L. frenatus: SMNS 21978 (1), New Caledonia, off Nouméa. L. lineatus: SMNS 22573 (4), Red Sea, Gulf of Aqaba, Egypt, 14 km north of Nuweiba. L. minor: SMNS 15130 (1), Fiji, Viti Levu; SMNS 17822 (2), Cook Islands, Aitutaki; SMNS 20909 (2), La Réunion, Les Filaos; SMNS 21020 (2), La Réunion, Les Filaos; SMNS 21161 (1), La Réunion, Les Filaos; SMNS 21178 (2), La Réunion, Saint-Leu; SMNS 22980 (1), Loyalty Islands, Lifou; SMNS 26966 (3), New Caledonia, Nouméa. Lepadichthys sp.: SMNS 21976 (1), New Caledonia, Baie Maá; SMNS 23962 (15), New Caledonia, Ile Nou; SMNS 26967 (4), New Caledonia, Nouméa; SMNS 26968 (1), New Caledonia, Nouméa. Lepadogaster candolii: SMNS 579 (1), Hvar Island, Croatia; SMNS 993 (1), Trieste, Italy; SMNS 2662 (6), Naples, Italy; SMNS 8996 (1), Senj, Croatia; SMNS 9416 (1), Cres Island, Croatia; SMNS 13176 (1), Giglio Island, Italy; SMNS 13575 (5), Saronic Gulf, Greece; SMNS 13576 (1), Elba Island, Italy; SMNS 13677 (1), Peloponnes, Greece; SMNS 13578 (3), Crete Island, Greece; SMNS 13579 (3), Muros, Galicia, Spain; SMNS 13580 (1), Saronic Gulf, Greece; SMNS 13581 (1), Costa Brava, Spain; SMNS 13582 (2), Elba Island, Italy; SMNS 13613 (1), Biograd, Croatia; SMNS 13614 (1), Sicily, Italy; SMNS 13615 (1), Sicily, Italy; SMNS 13616 (2), Corfu Island, Greece; SMNS 13620 (2), Corfu Island, Greece; SMNS 14700 (6), Reis Magos, Madeira; SMNS 14721 (2), Cres Island, Croatia; SMNS 16020 (1), Caniçal, Madeira; SMNS 16069 (1), Siciliy, Italy; SMNS 25479 (2), Caniço de Baixo, Madeira. L. lepadogaster: SMNS 1079 (1), Azores; SMNS 13556 (1), Biograd, Croatia; SMNS 13557 (1), Golfo di Trieste, Italy; SMNS 13558 (1), Bari, Italy; SMNS 13559 (1), Karlobag, Croatia; SMNS 13560 (2), Corfu Island, Greece; SMNS 13561 (5), Elba Island, Italy; SMNS 13562 (1), Collioure, Pyrenées-Orientales, France; SMNS 13563 (1), Crete Island, Greece; SMNS 13564 (1), Cap Negro, N Tétouan, Morocco; SMNS 13565 (2), Elba Island, Italy; SMNS 13566 (2), Sea of Marmara, Turkey; SMNS 13567 (1), İstanbul Province, Turkey, Black Sea; SMNS 13568 (1), Granada Province, Spain; SMNS 13569 (1), Banyuls-sur-Mer, France; SMNS 13570 (2), Gran Canaria, Canary Islands; SMNS 13617 (5), Costa Brava, Spain; SMNS 13618 (1), Corfu Island, Greece; SMNS 14699 (4), Reis Magos, Madeira; SMNS 16726 (6), Fuerteventura, Canary Islands; SMNS 19070 (1), Karavaş Alsavçak Bay, Northern Cyprus; SMNS 22609 (8), La Palma, Canary Islands; SMNS 25316 (1), Bodrum, Turkey; SMNS 25481 (2), Caniço de Baixo, Madeira. L. purpurea: SMNS 10295 (1), Lanzarote, Canary Islands; SMNS 12549 (1), Collioure, France; SMNS 13571 (1), Biograd, Croatia; SMNS 13572 (2), Saronic Gulf, Greece; SMNS 15286 (2), Cap Béar, Pyrenées Orientales, France; SMNS 15315 (2), La Palma, Canary Islands; SMNS 15328 (1), La Palma, Canary Islands; SMNS 16727 (4), Fuerteventura, Canary Islands; SMNS 16766 (2), Fuerteventura, Canary Islands; SMNS 22610 (4), La Palma, Canary Islands; SMNS 22623 (1), La Palma, Canary Islands; SMNS 23501 (5), El Hierro, Canary Islands. Liobranchia stria: USNM 149910 (holotype), Saipan, Marianas Islands. Modicus minimus: BMNH 1982.6.17.55 (1 paratype), North Island, New Zealand. Opeatogenys cadenati: MNHN 1959-0059 (holotype), Senegal; MNHN 1959-0060 (2 paratypes), Senegal. Parvicrepis parvipinnis: AMS I.7708 (5 syntypes), Sydney, New South Wales, Australia. Pherallodichthys meshimaensis: NSMT-P 46752 (holotype), Kyushu, Japan. Pherallodiscus funebris: CAS-SU 20 (9 paralectotypes), Gulf of California, Mexico. Pherallodus indicus: CAS-SU 47683 (1), Raroia, Tuamotu Archipelago. P. smithi: CAS-SU 31349 (holotype), KwaZulu-Natal, South Africa. Posidonichthys hutchinsi: AMS I.17615-002 (holotype), Fiddler's Bay, South Australia. Propherallodus briggsi: NSMT-P 46749 (holotype), Kyushu, Japan. Rimicola muscarum: CAS-SU 3030 (holotype), Monterey Bay, California, USA. Sicyases sanguineus: SMNS 390 (2), Chile. Tomicodon humeralis: CAS-SU 70 (5 syntypes), Gulf of California, Mexico. Trachelochismus melobesia: SMNS 13926 (1), South Island, New Zealand; SMNS 13940 (1), South Island, New Zealand. T. pinnulatus: SMNS 13925 (1), South Island, New Zealand; SMNS 13937 (1), South Island, New Zealand; SMNS 13939 (2), South Island, New Zealand; SMNS 13946 (4), South Island, New Zealand; SMNS 13950 (6), South Island, New Zealand; SMNS 13951 (34), South Island, New Zealand. Unguitrema nigrum: NTUM 10603 (holotype), Madang, Papua New Guinea; MNHN uncat. (1 paratype), same data as the holotype.

3 Results

3.1 Gobiesocid phylogeny

The combined dataset for inferring gobiesocid phylogeny contains the sequences of RAG1 gene (1476 bp), Rhodopsin gene (819 bp), EGR2B gene (855 bp), COI gene (633 bp), 12S gene (344 bp) and 16S gene (334 bp) from a total of 22 examined taxa that include 11 gobiesocid representatives from five out of their nine currently recognized subfamilies (Table 1). The total of 4461 nucleotides comprise 2184 variable sites (49%) and 736 parsimony-informative sites. The resulting ML tree is shown in Fig. 1.

Fig. 1

Phylogenetic tree of the Gobiesocidae inferred by the partitioned maximum-likelihood method with the GTR + Γ+I nucleotide substitution model based on the combined dataset. Branch lengths are proportional to the inferred nucleotide substitutions. Numbers at nodes represent bootstrap values in percentage. Values below 50% are not shown. An undetermined specimen of Arcos sp. was further determined to represent a recently described species, Acyrtus lanthanum Conway, Baldwin & White 2014 by COI sequence similarity.

From the inferred tree, the monophyly of the Gobiesocidae as well as its subfamilies Gobiesocinae and Cheilobranchinae is confirmed with 100% bootstrap nodal support. The Lepadogastrinae is monophyletic, but it received only week support. Among the outgroup taxa, the blennioids are the most closely related to the Gobiesocidae and their sister-group relationship is supported by a strong bootstrap value of 99%. Within the family, our result divides the gobiesocid taxa sampled in this study into two sub-groups (I and II), one containing the taxa from the Gobiesocinae and the other with the remaining gobiesocids in four subfamilies plus the newly discovered clingfish from deep water off the north coast of Papua New Guinea (see the description below) (Fig. 1). According to our phylogenetic result, we can induce that the new taxon is a gobiesocid of sub-group II, and it appears to be an independent gobiesocid lineage or subfamily as it is not tightly clustered with any known subfamilies of the Gobiesocidae, at least sampled in this study (Fig. 1).

3.2 Protogobiesocinae new subfamily (Figs. 2–6)

3.2.1 Type genus

Protogobiesox n. gen.

Fig. 2

Protogobiesox asymmetricus gen. nov., sp. nov., NTUM 10628, holotype, male, 60.0 mm SL, Papua New Guinea, Madang Province, northeast of Taviltae. A (upper) Lateral view; B (centre) dorsal view; C (lower) ventral view. Bar: 5 mm.

Fig. 3

Protogobiesox asymmetricus gen. nov., sp. nov., NTUM 10628, holotype, male, 60.0 mm SL, Papua New Guinea, Madang Province, northeast of Taviltae. A (upper left) Head, dorsal view, indicating lateral line canals and pores. B (upper right) head, frontal view, showing skull, eye and snout asymmetry. C (lower) pelvic fin disc. Bars: 3 mm.

Fig. 4

Protogobiesox asymmetricus gen. nov., sp. nov., NTUM 10628, holotype, male, 60.0 mm SL, Papua New Guinea, Madang Province, northeast of Taviltae. Photograph immediately after collection. Vertebral column bent towards the left-hand side.

Fig. 5

Protogobiesox asymmetricus gen. nov., sp. nov., MNHN XXXX-XXXX, paratype, female, 59.0 mm SL, Papua New Guinea, Madang Province, northeast of Taviltae. Photograph immediately after collection. Vertebral column bent towards the right-hand side.

Fig. 6

Lepadicyathus mendeleevi Prokofiev, 2005, ZIN 53413, holotype, female, 13.6 mm SL, Papua New Guinea, Madang Province, near Bongu. A (upper) Lateral view. B (centre) dorsal view. C (lower left) detail of postorbital region showing striae. D (lower right) pelvic disc. Bars: 1 mm.

3.2.2 Diagnosis

A subfamily of gobiesocid fishes with a partial lateral asymmetry; head slightly asymmetrical when seen from the front; vertebral column laterally bent, at an angle of 40–92°; anus situated on the right-hand side of the body in males, and on the left-hand side in females; position of guts slightly asymmetrical to strongly asymmetrical; gills 3; pelvic fin disc rudimentary, in two parts, at most with a few rudimentary papillae basally in region B. Pelvic bones present, pelvic fin forming a double disc; scapula, pectoral radial and rays present; total vertebrae 33–35.

3.2.3 Description

Dorsal-fin rays ix–xii; anal-fin rays viii–x; pectoral-fin rays xvii–xxiv; caudal-fin rays (iv-v),x-xv,(iv-v). Gills 3; gill rakers on 3rd arch 0–3.

Head lateral line system with 2 pores in the nasal canal, 1–2 pores in the postorbital canal, 0–2 pores in the lacrimal canal, 0–2 pores in the preopercular canal, and 0–2 pores in the mandibular canal. Vertebrae 33–35 (15 + 18–20). Pleural ribs 12–13 pairs.

Head broad, depressed. Head and skull at least slightly asymmetrical in frontal view. Gill membranes attached to isthmus. Pelvic bones present. Body bent to the left-hand side (males) or right-hand side (females); vertebral column bent at angle of 40–92°, bending starts between skull and level of anus. Anus situated on right-hand side of the body (males) or the left-hand side of the body (females); male with a short urogenital papilla. Skin naked; surface of head and body may bear striae.

Dorsal fin origin on the left-hand side of the body (males), and on the right-hand side (females); anal fin origin on the right-hand side of the body (males) or the left-hand side of the body (females). Dorsal and anal-fin bases attached to caudal-fin base by membranes. Pelvic fin forming a double disc; scapula, pectoral radial and rays present. Disc membrane inserting at the base of the 12th–16th pectoral-fin ray. Disc rudimentary, incomplete, completely or mostly without adhesive papillae.

3.2.4 Etymology

The name of the new subfamily is based on the type genus, Protogobiesox; its meaning is “ancestral gobiesocid,” referring to the pelvic fins resembling the putative ancestral form of gobiesocids.

3.2.5 Distribution

The two described species are distributed off the north coast of the main island of Papua New Guinea, western Pacific Ocean (Fig. 7).

Fig. 7

Geographical distribution of the species of the subfamily Protogobiesocinae n. subfam. in Papua New Guinea. ALepadicyathus medeleevi. BProtogobiesox asymmetricus gen. nov., sp. nov.

3.2.6 Comparisons

Within the family Gobiesocidae, this subfamily is unique in its lateral asymmetry. It further differs from the subfamily Cheilobranchinae in the presence of pelvic bones and a disc (pelvic bones and disc greatly reduced or absent in Cheilobranchinae), the presence of a scapula, pectoral radials and pectoral-fin rays (all these absent in the Cheilobranchinae, and the total vertebrae number 33–35 (60–78 in Cheilobranchinae), and from the other subfamilies in the presence of three gills (three and one half in the Chorisochisminae, Haplocyclicinae, Lepadogastrinae, Trachelochisminae), the gill membranes which are attached to the isthmus (free from isthmus in Diplocrepinae, Gobiesocinae, Haplocyclicinae, Trachelochisminae), the double disc (disc single in Chorisochisminae, Diademichthyinae, Gobiesocinae, Haplocyclicinae), and the disc region B lacking papillae or with very few rudimental papillae in 1–2 rows (with 6–10 rows of flattened papillae in the Aspasminae). A key to the subfamilies of the Gobiesocinae is presented below, as well as a key to the species of the Protogobiesocinae n. subfam.

3.2.7 Key to the subfamilies of the family Gobiesocidae

1a. Pelvic bones present, pelvic fin forming a single or double disc; scapula, pectoral radial and rays present; total vertebrae 25–54 2
1b. Pelvic bones and pelvic fin greatly reduced or absent; scapula, pectoral radial and rays absent; total vertebrae 60–78 Cheilobranchinae
2a. Gills three and one-half 3
2b. Gills three 6
3a. Gill membranes free from isthmus 4
3b. Gill membranes attached to isthmus 5
4a. Disc double (Indo-Pacific to Japan) Trachelochisminae
4b. Disc single (New Zealand) Haplocyclicinae
5a. Disc double (Eastern Atlantic and South Africa) Lepadogastrinae
5b. Disc single (South Africa) Chorisochisminae
6a. Gill membranes free from isthmus 7
6b. Gill membranes attached to isthmus 8
7a. Disc double (South Africa to Indo-Pacific; New Zealand) Diplocrepinae
7b. Disc single (America plus South Africa) Gobiesocinae
8a. Disc double (Indo-Pacific) 9
8b. Disc single (South Africa to Indo-Pacific) Diademichthyinae
9a. Body laterally symmetrical, vertebral column not bent; disc region B with 6–10 rows of flattened papillae (Indo-Pacific) Aspasminae
9b. Body laterally asymmetrical, vertebral column bent at an angle of 40–92°; disc region B lacking papillae or with very few rudimental papillae in 1–2 rows (Western Pacific) Protogobiesocinae n. subfam

3.2.8 Key to the species of the subfamily Protogobiesocinae n. subfam

1a. Dorsal fin with 9–10 rays; anal fin with 8 rays; caudal fin with 15 principal rays; vertebral column strongly bent at an angle of 85–92°; bending starts behind skull; skin naked, without striae Protogobiesox asymmetricus n. gen., n. sp.
1b. Dorsal fin with 11–12 rays; anal fin with 10 rays; caudal fin with 10 principal rays; vertebral column bent at an angle of 40–45°; bending starts just before level of anus; skin naked, with numerous, closely set, oblique striae consisting of minute tubercles Lepadicyathus mendeleevi

3.3 Protogobiesox new genus (Figs. 2–5)

3.3.1 Type species

Protogobiesox asymmetricus n. gen., n. sp.

3.3.2 Diagnosis

A genus of protogobiesocine fishes with a partial lateral asymmetry; head slightly asymmetrical when seen from the front; vertebral column strongly bent towards the left in males, towards the right in females, at an angle of 85–92°; bending starts behind the skull; anus situated on the right-hand side of the body in males, on the left-hand side in females; position of guts strongly asymmetrical; gills 3; pelvic fin disc rudimentary, in two parts, without adhesive papillae. Dorsal fin with 9–10 rays; anal fin with 8 rays; caudal fin with 15 principal rays. Skin naked, without striae.

3.3.3 Description

Dorsal-fin rays x (ix–x); anal-fin rays viii (viii); pectoral-fin rays xxiv (xvii–xxiv); caudal-fin rays (v),xv,(iv) [(iv–v),xv,(iv)]. Gills 3 (3); gill rakers on 3rd arch 3 (3).

Detailed description see below under Protogobiesox asymmetricus n. gen. n. sp.

3.3.4 Etymology

The name of the new genus means “ancestral gobiesocid;” it refers to the pelvic fins resembling the putative ancestral form of gobiesocids. The gender is masculine.

3.3.5 Remarks

This genus is monotypic, with Protogobiesox asymmetricus n. gen., n. sp. as the only known species.

3.4 Protogobiesox asymmetricus n. sp. (Figs. 2–5)

Asymmetrical deep-water clingfish.

3.4.1 Type material

Holotype. NTUM 10628, male, 60.0 mm SL, Papua New Guinea, Madang Province, northeast of Taviltae, 4°31'S 145°31’E, 380-382 m depth, St. CP4035, sunken logs, some covered with sponges, W.-J. Chen, R/V Alis, 17 Dec. 2012.

Paratypes. Four specimens: MNHN 2016-03333, 1 female, 59.0 mm SL, same data as the holotype; NTUM 10633, 1 male, 53.6 mm SL, same data as holotype; NTUM 10629, 1 male, 56.0 mm SL, Papua New Guinea, Sandaun Province, northwest of Aitape, 3°01'S 142°16’E, 400–560 m in depth, St. CP4056, sand bottom with sunken logs, W.-J. Chen, R/V Alis, 20 Dec. 2012; NTUM 10674, 1 male, 51.8 mm SL, Papua New Guinea, West Sepik Province, 13.5 km northwest of Aitape, 3°03'S 142°18’E, 370–374 m depth, St. CP 4055, Wei-Jen Chen, R/V Alis, 20 Dec. 2012.

3.4.2 Diagnosis

Dorsal fin with 9–10 rays, anal fin with 8 rays, pectoral fin with 17–24 rays, principal caudal-fin rays 15, three gills, third arch with 3 gill rakers. Vertebral column with a total of 34–35 vertebrae, with asymmetrical lateral bending starting behind the skull, bent at an angle of 85°–92°. Skull asymmetrical in frontal view. Skin naked, surface of head and body without striae. Disc without adhesive papillae; posterior margin may be partially fringed; region B small, left- and right-hand sides separate, larger on the right-hand side than on left-hand side.

3.4.3 Description

Dorsal-fin rays x (ix–x); anal-fin rays viii (viii); pectoral-fin rays xxiv (xvii–xxiv); caudal-fin rays (v),xv,(iv) [(iv–v),xv,(iv)]. Gills 3 (3); gill rakers on 3rd arch 3 (3). Measurements of the holotype and paratypes, see Table 3.

Table 3

Counts and measurements of the holotype and paratypes of Protogrammus asymmetricus n. gen. n. sp.

Table 3
Holotype
NTUM
10628
Male
Paratype
NTUM
10674
Male
Paratype
NTUM
10629
Male
Paratype
NTUM
10633
Male
Paratype
MNHN
2016-03333
Female
Standard length 60.0 51.8 56.0 53.6 59.0
Head length 20.7 16.6 18.5 18.0 19.3
Body depth 6.4 4.4 5.4 6.3 6.0
Body width 11.5 9.5 10.8 12.6 11.4
Orbit diameter 5.3 6.3 5.1 4.9 5.8
Preorbital length 4.4 2.1 4.1 3.9 4.1
Interorbital distance 1.4 0.7 1.5 0.6 0.9
Upper jaw length 8.1 4.8 7.3 6.7 7.7
Lower jaw length 6.4 4.1 6.0 5.5 7.3
Preanus length 36.7 32.9 33.3 31.5 35.9
Urogenital papilla 0.3 0.2 0.3 0.2
PC length 5.3 5.5 4.6 4.7 6.1
PC depth 6.5 4.6 5.2 4.9 6.0
PC width 1.4 1.6 1.1 2.0 1.4
Predorsal length 43.9 35.9 42.1 38.4 42.4
Preanal length 45.6 40.0 41.4 40.4 46.2
Distance disc to anus 14.6 ? 10.4 10.9 9.9
Distance anus to anal-fin origin 9.2 8.1 7.1 7.7 6.9
Prepectoral length 20.6 17.0 20.7 20.7 22.0
Predisc length 13.2 11.0 12.4 11.9 14.2
1st dorsal ray 5.3 3.2 5.1 4.8 4.1
Last dorsal ray 6.0 5.5 4.0 4.6 5.3
Dorsal-fin base 14.6 7.9 11.0 8.9 12.2
1st anal ray 4.5 2.5 3.9 2.7 2.9
Last but one anal ray 6.5 3.1 5.8 4.3 4.6
Last anal ray 5.1 2.4 4.7 3.9 4.1
Anal-fin base length 9.5 6.8 9.5 8.3 9.5
Pectoral-fin length 10.4 9.7 10.7 9.8 10.6
Pectoral-fin base 3.6 3.6 3.9 3.9 4.3
Disc length 16.0 ? 11.4 11.0 13.9
Caudal-fin length 12.8 10.6 11.4 10.2 12.4

Both upper and lower jaws with several series of undifferentiated conical teeth, no canines or incisors.

Head lateral line system with 2 pores in the nasal canal, 1 pore in the postorbital canal, lacrimal and preopercular canals missing, and 2 pores in the mandibular canal (Figs. 2 and 3).

Vertebrae 35 (34–35) [15 + 20 (15 + 19–20)]; asymmetrical bending of the vertebral column starting from the 1st (1st) vertebra. Pleural ribs 13 (13) pairs.

Head broad, depressed. Head and skull asymmetrical in frontal view (Fig. 3B). Head length 34.5 (32.0–33.6)% SL (2.9–3.1 in SL). Maximum body depth 10.7 (8.5–11.8)% SL (8.5–11.8 in SL). Maximum body width 19.2 (18.3–23.5)% SL (4.2–5.4 in SL). Maximum (horizontal) orbit diameter 8.8 (9.1–12.2)% SL (2.6–3.9 in head length). Snout relatively long, pointed (Fig. 3A). Preorbital length 7.3 (4.0–7.3)% SL (4.5–7.9 in head length). Interorbital distance narrow, 2.3 (1.1–2.7)% SL (12.3–30.0 in head length). Upper jaw length 13.5 (9.3–13.0)% SL. Lower jaw length 10.7 (7.9–12.4)% SL. Gill membranes attached to isthmus. Body bent to the left-hand side (males) or right-hand side (females); vertebral column bent at angle of 87° (85–92°), bending starts behind skull. Anus situated on the right-hand side of the body (male) or the left-hand side of the body (female); closer to anal-fin origin than the disc; male with a short urogenital papilla, its length 0.5 (0.4–0.5)% of SL (62–90 in head length); distance between disc and anus 24.3 (16.8–20.3)% SL, distance between anus and anal-fin origin 15.3 (11.7–15.6)% SL. Pre-anus length 61.2 (58.8–63.5)% SL (1.6–1.7 in SL). Sides of body with an elongate dermal fold on left-hand side below the anal-fin base. Caudal-peduncle length 8.8 (8.2–10.6)% SL (9.4–12.2 in SL). Caudal-peduncle depth 10.8 (8.9–10.2)% SL (9.2–11.3 in SL). Caudal-peduncle width 2.3 (2.0–3.7)% SL (26.8–50.9 in SL). Skin naked; surface of head and body without striae.

Predorsal-fin length 73.2 (69.3–75.2)% SL (1.3–1.4 in SL). Pre-anal-fin length 76.0 (77.2–78.3)% SL (1.3–1.4 in SL). Dorsal fin origin on the left-hand side of the body (male), on the right-hand side of the body (female); anal fin origin on the right-hand side of the body (male), on the left-hand side of the body (female). Dorsal and anal-fin bases attached to caudal-fin base by membranes. Prepectoral-fin length 34.3 (32.8–38.6)% SL (2.6–3.0 in SL). Predisc length 22.0 (21.2–24.1)% SL (4.2–4.7 in SL). Disc length 26.7 (20.4–23.6)% SL (3.8–4.9 in SL). Disc membrane inserting at the base of the 13th (13th) pectoral-fin ray. Disc rudimentary, incomplete, with left- and right-hand parts of regions A and B separate, without adhesive papillae; fin-ray branches at distal margins with short filaments; region B small (Fig. 3C). Caudal-fin length 21.4 (19.0-21.0) % SL (4.7-5.2 in SL).

Colour in life (Figs. 4 and 5). Head and body brown, with an irregular, slightly darker banding, anteriorly reddish, posteriorly yellowish; eyes dark grey. Pectoral-fin rays reddish, caudal fin rose; dorsal and anal-fin rays rose, membranes blackish.

Colour in alcohol. Head and body uniformly yellowish brown, lower sides of head and body pale; eyes dark grey; occiput transparent, brain visible, yellowish white; peritoneum black. Dorsal and anal fins and distal margin of caudal fin dark grey.

3.4.4 Distribution

North coast of Papua New Guinea (Madang Province; Sandaun Province) (Fig. 7). This new species was collected at depths of 381–480 m.

3.4.5 Etymology

The name of the new species, asymmetricus, refers to the unusual asymmetry of head and body.

3.4.6 Comparisons

This new species is distinguished from the related species Lepadicyathus mendeleevi by its 9–10 dorsal-fin rays (11–12 in L. mendeleevi), the 8 anal-fin rays (10 in L. mendeleevi), 15 principal caudal-fin rays (10 in L. mendeleevi), the vertebral column strongly bent at an angle of 85–92° (40–45° in L. mendeleevi), the bending that starts behind the skull (just before the level of the anus in L. mendeleevi), and the naked skin without striae (with numerous, closely-set, oblique striae consisting of minute tubercles in L. mendeleevi). From other gobiesocids, it is distinguished by the characters of the subfamily (see above).

3.4.7 Remarks

This species is highly asymmetrical. While the head is normally orientated, the skull is already slightly asymmetrical when seen from the front (Fig. 3B), with an oblique mouth slit and the left eye situated lower than the right eye in the male holotype; the vertebral column inserts slightly on the left-hand side of the skull (Fig. 2B), and then strongly turns left, meeting the left-hand side of the body on the level of the dorsal fin insertion; it continues running along the left-hand side towards the hypural plate. The anal fin, consequently, inserts on the right-hand side of the body; the caudal fin lies flat on the ground. Asymmetries are also found in the position of the internal organs, which are restricted to the right half of the body (Fig. 2C); the anus is situated on the right-hand side. Asymmetries are observed also in the pectoral and pelvic fin skeletons; the fins and supporting elements on right-hand side and are much smaller than the corresponding elements on the left-hand side (disc asymmetry, see Fig. 3C). In the female paratype, the asymmetries are the other way around, with the vertebral column turning towards the right-hand side of the fish, and the anus and the internal organs shifted towards the left-hand side. These asymmetries are not artificial, as all four specimens of the type series show exactly the same pattern, which was already apparent in the freshly collected fish.

The right pectoral fins, and right lobes of the pelvic disc, were partially removed for molecular studies prior to the morphological examination.

This new species is found in relatively cool water in an area with temporary upwelling along the northern coast of Papua New Guinea (Kuroda [70], Lee et al. [71], Hasegawa et al. [72]). It was found in association with sunken logs; its specializations and especially the lateral asymmetry may be useful to be attached to these logs.

3.5 Lepadicyathus Prokofiev, 2005 (Fig. 6)

3.5.1 Synonymy

Lepadicyathus Prokofiev 2005: Prokofiev [42]: 559 [546] (type species: Lepadicyathus mendeleevi Prokofiev 2005 by original designation (also monotypic).

3.5.2 Diagnosis

A genus of protogobiesocine fishes with a partial lateral asymmetry; head slightly asymmetrical when seen from the front; vertebral column bent towards the left in males, towards the right in females, at an angle of 40–45°; bending starts slightly before level of anus; anus situated towards the right-hand side of the body in males, towards the left-hand side in females; position of guts slightly asymmetrical; gills 3; pelvic fin disc rudimentary, in two parts, with a few rudimentary papillae basally in region B. Dorsal fin with 11–12 rays; anal fin with 10 rays; caudal fin with 10 principal rays. Skin naked, surface of head and body covered with a dense pattern of obliquely arranged striae consisting of minute tubercles.

3.5.3 Description

Dorsal-fin rays xi–xii; anal-fin rays x; pectoral-fin rays xxiv; caudal-fin rays (v),x,(v). No gill rakers on 3rd arch; 1–2 gill rakers on the 1st and 2nd arches.

Premaxillary with a single row of incisor-like teeth, some with a hook-like appendage. Dentary with a single row of smaller incisor-like teeth, fused at the bases.

Head lateral line system with 2 pores in the nasal canal, 2 pores in the postorbital canal, 2 pores in the lacrimal canal, and 2 pores in the preopercular canal, pores in mandibular canal lacking.

Pelvic disc rudimentary, in two parts; anterior margin with small fringes; disc only with a few rudimentary papillae basally in region B.

Skin naked; surface of head and body covered with a dense pattern of obliquely arranged striae consisting of minute tubercles (Fig. 6C).

3.5.4 Remarks

The dermal striae found in Lepadicyathus are an unusual, specialised character not found in other gobiesocids. Prokofiev [42] compared it with Liobranchia stria of Briggs [3], which has deep grooves in the skin, but the state of Liobranchia is quite different from that of Lepadicyathus. Liobranchia has just grooves surrounded by folds, while the skin of Lepadicyathus is even, but covered with striae consisting of minute tubercles. This seems to be an independent specialisation, though we are unaware of the function of these striae. The tubercles may be based on reduced scales, which would support the primitive state of Lepadicyathus.

3.6 Lepadicyathus mendeleevi Prokofiev, 2005 (Fig. 6)

Mendeleev's clingfish.

3.6.1 Synonymy

Lepadicyathus mendeleevi Prokofiev 2005: Prokofiev [42]: 560 (547) (Papua New Guinea, near village of Bongu, Madang Province, 1 m depth. Holotype: ZIN 53413). Prokofiev [73]: 181 (discussion on systematic position).

3.6.2 Material

ZIN 53413 (holotype, female, 13.6 mm SL), Papua New Guinea, Madang Province, near Bongu, 1 m depth, in Millepora coral, R/V Dmitrii Mendeleev, Cruise 18,14 Feb. 1977. ZIN 53413a (1 paratype, male, 13.9 mm SL), same data as the holotype.

3.6.3 Diagnosis

Dorsal fin with 11–12 rays, anal fin with 10 rays, pectoral fin with 24 rays, principal caudal-fin rays 10, three gills, third arch without gill rakers. Vertebral column with a total of 33 vertebrae, with asymmetrical bending staring just before the level of the anus, bent at an angle of 40–45°. Skull not asymmetrical in frontal view. Skin naked, surface of head and body, with numerous, closely set, oblique striae consisting of minute tubercles. Disc without adhesive papillae, except a few basally in region B, arranged in two rows; posterior margin not fringed; region B small, left and right-hand sides connected by a membrane.

3.6.4 Description

Dorsal-fin rays xii (xi); anal-fin rays x (x); pectoral-fin rays xxiv (xxiv); caudal-fin rays (v),x,(v) [(v),x,(v)]. Gills 3 (3); no gill rakers on 3rd arch; 1-2 gill rakers on 1st and 2nd arches. Measurements of the holotype and paratypes: see Table 4.

Table 4

Counts and measurements of the holotype and paratype of Lepadicyathus mendeleevi Prokofiev, 2005.

Table 4
Holotype
ZIN
53413
Female
Paratype
ZIN
53413a
Male
Standard length 13.6 13.9
Head length 4.9 4.4
Body depth 1.5 1.5
Body width 2.9 2.8
Orbit diameter 1.4 1.7
Preorbital length 1.2 1.5
Interorbital distance 1.0 1.0
Upper jaw length 0.6 0.6
Lower jaw length 0.4 0.4
Preanus length 8.4 10.3
Urogenital papilla 0.05
PC length 0.5 0.6
PC depth 1.1 1.2
PC width 0.7 0.8
Predorsal length 10.1 10.4
Preanal length 9.7 11.3
Distance disc to anus 1.2 2.4
Distance anus to anal-fin origin 1.2 2.45
Prepectoral length 5.5 5.8
Predisc length 4.4 4.1
1st dorsal ray 1.1 1.2
Last dorsal ray ca. 0.8 1.0
Dorsal-fin base 3.0 4.4
1st anal ray 1.0 1.1
Last but one anal ray 1.4 1.5
Last anal ray 0.9 1.0
Anal-fin base length 2.4 2.9
Pectoral-fin length 1.5 1.3
Pectoral-fin base 1.0 1.4
Disc length 2.5 2.6
Caudal-fin length 1.9 ca. 1.8

Premaxillary with a single row of incisor-like teeth, some with a hook-like appendage. Dentary with a single row of smaller incisor-like teeth, fused at bases.

Head lateral line system with 2 pores in the nasal canal, 2 pores in the postorbital canal, 2 pores in the lacrimal canal, and 2 pores in the preopercular canal, pores in the mandibular canal lacking.

Vertebrae 33 (15 + 18); asymmetrical bending of vertebral column starting from 11th vertebra. Pleural ribs 12 pairs.

Head moderately broad, depressed. Head and skull slightly asymmetrical in frontal view. Head length 36.0 (31.6)% SL (2.8–3.2 in SL). Maximum body depth 11.9 (10.8)% SL (9.1–9.4 in SL). Maximum body width 21.3 (20.1)% SL (4.7–5.0 in SL). Maximum (horizontal) orbit diameter 10.3 (12.2)% SL (2.6–3.5 in head length). Snout elongate, slightly pointed, tip rounded (Fig. 6B). Preorbital length 8.8 (10.8)% SL (2.9–4.1 in head length), in the male not longer than in the female. Interorbital distance 7.4 (7.2) %SL (4.4–4.9 in head length). Upper jaw length 4.4 (4.3)% SL. Lower jaw length 2.9 (2.9)% SL. Gill membranes attached to the isthmus. Body bent to the left-hand side (male) or the right-hand side (female); vertebral column bent at an angle of 40° (45°), bending starts just before the level of the anus. Anus situated in the middle between the disc and anal-fin origin; both sexes with a short urogenital papilla; distance between disc and anus 8.8 (17.3)% SL, distance between anus and anal-fin origin 8.8 (17.6)% SL. Anus situated only slightly towards the right-hand side of the body (male) or the left-hand side of the body (female). Pre-anus length 61.8 (74.1)% SL (1.4–1.6 in SL). Sides of body without an elongate dermal fold below the base of the anal fin. Caudal-peduncle length 3.7 (4.3)% SL (23.2–27.2 in SL). Caudal-peduncle depth 8.1 (8.6)% SL (11.6–12.4 in SL). Caudal-peduncle width 5.1 (5.8)% of SL (17.3–19.4 in SL).

Predorsal-fin length 74.3 (74.8)% SL (1.3-1.4 in SL). Pre-anal-fin length 71.3 (81.3)% SL (1.2–1.4 in SL). Dorsal fin origin towards the left-hand side of the body (male), the right-hand side of the body (female); anal fin origin near the right-hand side of the body (male), the left-hand side of the body (female). Prepectoral-fin length 40.4 (41.7)% SL (2.4-2.5 in SL). Predisc length 32.3 (29.5)% SL (3.1–3.4 in SL). Disc length 18.4 (18.7)% SL (5.3–5.4 in SL). Disc membrane inserting at the base of the 12th (16th) pectoral-fin ray. Pelvic disc rudimentary, in two parts; anterior margin of region A and posterior margin of region B with small fringes; disc only with a few rudimentary papillae basally in region B. Caudal-fin length 14.0% SL (7.2 in SL). Skin naked; surface of head and body covered with a dense pattern of obliquely arranged striae consisting of minute tubercles (Fig. 6C).

Colour in life.–Unknown.

Colour in alcohol.–The holotype and paratype are reddish brown, the head and anterior dorsal surface carmesine red, with 5 white stripes; one stripe running from the tip of the snout along the dorsal midline to the dorsal-fin base (Fig. 6B), a lateral stripe on each side from posterior margin of eye to the dorsal part of the caudal peduncle, and another lateral stripe on each side from below the dentary to the lower part of the caudal peduncle. Eye dark grey. Occiput not transparent. Fins reddish; caudal fin with a basal brown spot, central part of fin carmesine red.

3.6.5 Distribution

North coast of Papua New Guinea (Madang Province) (Fig. 7). This new species is known only from the type locality. It was collected at a depth of 1 m, inhabiting a Millepora coral.

3.6.6 Remarks

Prokofiev [42] noticed that the paratype of Lepadicyathus mendeleevi was “crumpled”, but thought this to be artificial, and was apparently not aware of the lateral asymmetry. During a re-examination, however, the moderate asymmetry of this species was discovered both in the holotype and the paratype. In the female holotype, an ovary full of moderately large eggs was visible in the X-ray image.

While the head is normally orientated, the skull is already slightly asymmetrical when seen from the front, with a slightly oblique mouth slit and one cheek larger than the other; in the female holotype, the vertebral column is bent towards the right-hand side (Fig. 6B), with the anus placed slightly towards the left-hand side of the body; the vertebral column is bent to the left-hand side in the male paratype, with the anus closer to the right-hand side. A slight asymmetry is also found in the position of the internal organs, which are shifted towards the left-hand side of the body in the female holotype, but towards the right-hand side of the body in the male paratype.

In a note published subsequently to the original description, Prokofiev [73] noted that the absence of papillae on the disc of Lepadicyathus mendeleevi is not unique in Gobiesocidae, but resembles young specimens of the genus Lepadichthys. However, the holotype of L. mendeleevi is certainly to be considered as an adult specimen, as the ovary is full of eggs.

4 Discussion

Chen et al. [60], in a molecular phylogenetic analysis of the Acanthomorpha, demonstrated that the order Perciformes is polyphyletic, and that several of the discovered clades need formal recognition. From the phylogenetic results of Chen et al. [60], the Gobiesocidae formed a separate clade (Clade D) together with the blennioids; this clade was nested within the inferred clade Q (Chen et al. [60]; Dettaï & Lecointre [61]) or Ovalentaria (Wainwright et al. [74]) of the Percomorpha contained Atherinomorpha, Mugilidae, Pomacentridae (“Labroidei”), Cichlidae (“Labroidei”), Embiotocidae (“Labroidei”), Ambassidae, and some other perciform fishes from Pholidichthyidae, Pseudochromidae, Polycentridae, Plesiopidae, Opistognathidae, and Grammatidae (Near et al. [62]). Our phylogenetic result, by including the main taxa from the clade Q, confirms the previous hypothesis (Fig. 1), and suggest the clade including Blennioidei and Gobiesocidae should be formally named in the future. Very recently, Nelson et al. [75] classified the Gobiesociformes as a separate order for the single family Gobiesocidae, which they considered as closely related to the Blenniiformes (= Blennioidei) (see Lin & Hastings [76]). However, the authors these studies did not give the reason for their rearrangement of the taxonomic rank at the ordinal level; the classification should further be settled.

Within the family Gobiesocidae, a total of 9 subfamilies were previously distinguished (Briggs [3], Conway et al. [56]); five of these were included for the present molecular phylogenetic investigation. The new subfamily Protogobiesocinae is morphologically most similar to the subfamily Aspasminae. Species of the Aspasminae are distributed from East Africa east to Mariana Islands, north to Japan, south to southern Australia and New Zealand; they are known from very shallow to moderately deep water. The deepest occurring aspasmine species are Aspasma minima (Döderlein, 1887) from Japan (183–274 m), and Modicus tangaroa Hardy, 1983 from New Zealand (20–149 m). However, our molecular results revealed that the sister-group of the Aspasminae is the Diademichthyinae, a group of the Indo-West Pacific distributed clingfishes specialized for a commensal relationship with certain shallow-reef crinoids. Interestingly, the enigmatic clingfishes from the subfamily Cheilobranchinae turned out to be the sister-group of the Aspasminae/Diademichthyinae clade in the inferred phylogenetic tree (Fig. 1). The species in the new subfamily Protogobiesocinae also possess a reduced or “ancestral” form of their adhesive disc formed by the pelvic fins, similar to the species of Cheilobranchinae. According to our phylogeny, this feature is apparently a derived state and has been evolved twice within the Gobiesocidae

Acknowledgments

The “Our Planet Reviewed” PAPUA NIUGINI Biodiversity Expedition was a joint project of Pro-Natura International (PNI), “Muséum national d’histoire naturelle”, Paris (MNHN), “Institut de recherche pour le développement” (IRD) and the University of Papua New Guinea (UPNG) – the principal investigators were Philippe Bouchet, Claude Payri, and Sarah Samadi. The organizers acknowledge funding from the Total Foundation, the Prince Albert II of Monaco Foundation, the Fondation EDF, the Stavros Niarchos Foundation and Entrepose Contracting, Fonds Pacifique, the Government of New Caledonia, and the kind support from the Divine Word University (DWU). The expedition operated under a permit delivered by the Department of Environment and Conservation of Papua New Guinea.

We appreciate the support by Sarah Samadi (MNHN, Paris) who provided information on station data and photographs of specimens collected during the PAPUA NIUGINI Biodiversity Expedition. We would also like to thank M. McGrouther, D.F. Hoese and J.R. Paxton (AMS, Sydney), D. Didier (ANSP, Philadelphia), O. Crimmen, J. Maclaine, A. Wheeler and P.J.P. Whitehead [†] (BMNH, London), J.E. Randall and A.Y. Suzumoto (BPBM, Honolulu), L.J. Dempster, W.N. Eschmeyer, M. Hearne, T. Iwamoto and P.M. Sonoda (CAS-SU, San Francisco), A. Brito (CCML, La Laguna, Tenerife), M.-L. Bauchot, M. Desoutter, G. Duhamel and P. Pruvost (MNHN, Paris), H. Ahnelt, R. Hacker [†] and P. Kähsbauer [†] (NMW, Vienna), K. Matsuura (NSMT-P, Tokyo), M.E. Anderson and V. Mthombeni (SAIAB, Grahamstown), J.T. Williams (USNM, Washington D.C.), A.V. Balushkin (ZIN, St. Petersburg), M.A. Krag, P.R. Møller and J.C. Nielsen (ZMUC, Copenhagen) and who gave access to specimens in their care, and provided information and/or photographs. We are grateful to M.J. Zhukov (ZIN, St. Petersburg) who provided assistance and prepared x-rays of Lepadicyathus mendeleevi., and to G. Duhamel and P. Pruvost (MNHN, Paris) who provided a catalogue number for a paratype. We wish to thank Kevin Conway, Bruno Chanet, Masaki Miya and The Australian Museum Sydney (via Mark McGrouther) for the loan or gift of tissue samples. WJC appreciates the grant support from the Ministry of Science & Technology, Taiwan (MOST 102-2923-B-002 -001-MY3).


References

[1] G.S. Hardy A new genus and species of deepwater clingfish (family Gobiesocidae) from New Zealand, Bull. Mar. Sci., Volume 34 (1984), pp. 244-247

[2] J.B. Hutchins Description of a new deepwater clingfish (Gobiesocidae) from New South Wales, Rec. W. Austr. Mus., Volume 15 (1991) no. 2, pp. 463-468

[3] J.C. Briggs A monograph of the clingfishes (order Xenopterygii), Stanford Ichthyol. Bull., Volume 6 (1955) (i-iv+1-224)

[4] V.G. Springer; T.H. Fraser Synonymy of the fish families Cheilobranchidae (=Alabetidae) and Gobiesocidae, with descriptions of two new species of Alabes, Smithsonian Contr. Zool., Volume 234 (1976) (i-iii+1-i-iii+23)

[5] J.C. Briggs A new genus and two new species of Eastern Atlantic clingfishes, Copeia (1957), pp. 204-208

[6] J.L.B. Smith Fishes of Aldabra, Part VIII, Ann. Mag. Nat. Hist. (12), Volume 10 (1957) no. 113, pp. 395-400 (pls. 13-14)

[7] J.C. Briggs A new clingfish of the genus Gobiesox from the Tres Marias Islands, Copeia, Volume 1960 (1960) no. 3, pp. 215-217

[8] J.C. Briggs; R.R. Miller Two new freshwater clingfishes of the genus Gobiesox from southern Mexico, Occas. Pap. Mus. Zool. Univ. Michigan, Volume 616 (1960), pp. 1-15 (pls. 1-4)

[9] J.C. Briggs A new clingfish of the genus Lepadichthys from the New Hebrides, Copeia (1962), pp. 424-425

[10] J.C. Briggs A new clingfish of the genus Gobiesox from the Bahamas, Copeia (1963), pp. 604-606

[11] J.C. Briggs; G. Link New clingfishes of the genus Lepadichthys from the northern Indian Ocean and Red Sea (Pisces, Gobiesocidae), Senckenb. Biol., Volume 44 (1963), pp. 101-105

[12] A.A. Murgoci Contribution à la connaissance des gobiesocides (ordre des Xenopterygii) de la mer Noire, Rev. Roum. Biol., Sér. Zool., Volume 9 (1964) no. 5, pp. 297-306

[13] J.L.B. Smith The clingfishes of the western Indian Ocean and the Red Sea, Ichthyol. Bull. Dep. Ichthyol. Rhodes Univ., Volume 30 (1964), pp. 581-596 (pls. 92-97)

[14] J.C. Briggs, Gobiesocidae, pp. 651-656, in: J.C. Hureau, T. Monod (Eds.), Check-list of the fishes of the north-eastern Atlantic and of the Mediterranean, Volume 1, CLOFNAM, UNESCO, Paris, 1973, pp. i–xxii+1-683.

[15] J.C. Briggs A new clingfish of the genus Lepadichthys from the Red Sea, (Contribution to the knowledge of the Red Sea, no. 35), Bull. Min. Agric. Dep. Fish. Sea Fish. Res. Stat. Haifa, Volume 42 (1966), pp. 37-40

[16] J.L.B. Smith A new clingfish from southern Mozambique, Ann. Mag. Nat. Hist. (13), Volume 8 (1966) no. 95, pp. 641-644 (pl. 19)

[17] J.C. Briggs A new clingfish (Gobiesocidae) of the genus Tomicodon from Ecuador, Copeia (1969), pp. 75-76

[18] J.C. Briggs A new genus and species of clingfish (family Gobiesocidae) from the Bahama Islands, Copeia (1969), pp. 332-334

[19] J.C. Briggs A new species of Lepadichthys (Gobiesocidae) from the Seychelles, Indian Ocean, Copeia (1969), pp. 464-466

[20] J.C. Briggs The clingfishes (Gobiesocidae) of Panama, Copeia (1969), pp. 774-778

[21] W.F. Smith-Vaniz A new clingfish, Tomicodon rhabdotus family Gobiesocidae, from the Lesser Antilles, Proc. Biol. Soc. Washington, Volume 81 (1969), pp. 473-477

[22] J.E. Böhlke; C.R. Robins A new genus and species of deep-dwelling clingfish from the Lesser Antilles, Notul. Nat., Volume 434 (1970), pp. 1-12

[23] T.H. Fraser Two new species of the clingfish genus Derilissus (Gobiesocidae) from the western Atlantic, Copeia (1970), pp. 38-42

[24] W.F. Smith-Vaniz Another new species of the clingfish genus Derilissus from the western Atlantic (Pisces: Gobiesocidae), Copeia (1971), pp. 291-294

[25] J.C. Briggs A new genus and species of clingfish from the western Pacific, Copeia (1976), pp. 339-341

[26] G.R. Hardy A new genus and two new species of clingfishes (Gobiesocidae) from New Zealand, Copeia (1983), pp. 863-868

[27] J.B. Hutchins Redescription of the clingfish Cochleoceps spatula (Gobiesocidae) from Western Australia and South Australia, with the description of a new species from Victoria and Tasmania, Rec. W. Austr. Mus., Volume 11 (1983) no. 1, pp. 33-47

[28] M. Shiogaki; Y. Dotsu Two new genera and two new species of clingfishes from Japan, with comments on head sensory canals of the Gobiesocidae, Jap. J. Ichthyol., Volume 30 (1983) no. 2, pp. 111-121

[29] G.S. Hardy A new genus and species of deepwater clingfish (family Gobiesocidae) from New Zealand, Bull. Mar. Sci., Volume 34 (1984) no. 2, pp. 244-247

[30] J.B. Hutchins Description of a new gobiesocid fish from south-western Australia, with a key to the species of Aspasmogaster, Rec. W. Austr. Mus., Volume 11 (1984) no. 2, pp. 129-140

[31] W.A. Szelistowski A new clingfish (Teleostei: Gobiesocidae) from the mangroves of Costa Rica, with notes on its ecology and early development, Copeia (1990), pp. 500-507

[32] J.B. Hutchins Description of a new deepwater clingfish (Gobiesocidae) from New South Wales, Rec. W. Austr. Mus., Volume 15 (1991), pp. 463-468

[33] J.C. Briggs New genus and species of clingfish (Gobiesocidae) from southern Australia, Copeia (1993), pp. 196-199

[34] H. Espinosa Pérez; J.L. Castro-Aguirre A new freshwater clingfish (Pisces: Gobiesocidae) from Baja California Sur, México, Bull. S. Calif. Acad. Sci., Volume 95 (1996) no. 3, pp. 120-126

[35] R. Hofrichter; R.A. Patzner A new species of Apletodon from the Mediterranean Sea and the eastern Atlantic with notes on the differentiation between Apletodon and Diplecogaster species (Pisces: Teleostei: Gobiesociformes: Gobiesocidae), Senckenb. Biol., Volume 77 (1997), pp. 15-22

[36] J.C. Briggs New species of Lepadichthys from the Philippine Islands, Copeia (2001), pp. 499-500

[37] J.C. Briggs New clingfish (Gobiesocidae) from Isla Grande, Colombia, Copeia (2001), pp. 745-746

[38] J.C. Briggs New species of Rimicola from California, Copeia (2002), pp. 441-444

[39] J.T. Williams; J.C. Tyler Revision of the Western Atlantic clingfishes of the genus Tomicodon (Gobiesocidae), with descriptions of five new species, Smithson Contrib Zool., Volume 621 (2003), pp. 1-26

[40] J.B. Hutchins; S. Morrison Five new species of the genus Alabes (Gobiesocidae: Cheilobranchinae), Rec. Austr. Mus., Volume 56 (2004) no. 2, pp. 147-158

[41] C.L.S. Sampaio; J. de Anchieta; C.C. Nunes; L.F. Mendes Acyrtus pauciradiatus, a new species of clingfish (Teleostei: Gobiesocidae) from Fernando de Noronha Archipelago, Pernabuco State, northeastern Brazil, Neotrop. Ichthyol., Volume 2 (2004) no. 4, pp. 205-208

[42] A.M. Prokofiev A new genus and species of clingfish (Gobiesociformes: Gobiesocidae) from New Guinea, Vopr. Ikht., Volume 45 (2005) no. 4, pp. 559-563 [In Russian. English translation appeared in J. Ichthyol. 45 (7) 2005, 546–550]

[43] J.B. Hutchins Description of two new species of shore-eels (Gobiesocidae: Cheilobranchinae: Alabes) from south-eastern Australia and Norfolk Island, Mem. Mus. Vict., Volume 63 (2006) no. 1, pp. 25-28

[44] R. Fricke A new species of the clingfish genus Apletodon (Teleostei: Gobiesocidae) from Sao Tome and Principe, Eastern Central Atlantic, Ichthyol. Res., Volume 54 (2007), pp. 68-73

[45] M.T. Craig; J.E. Randall Two new species of the Indo-Pacific clingfish genus Discotrema (Gobiesocidae), Copeia (2008), pp. 68-74

[46] M.T. Craig; J.E. Randall Briggsia hastingsi, a new genus and species of clingfish from Oman, Zootaxa, Volume 2271 (2009), pp. 64-68

[47] R. Fricke; P. Wirtz; A. Brito A new species of the clingfish genus Apletodon (Teleostei: Gobiesocidae) from the Cape Verde Islands, Eastern Central Atlantic, Ichthyol. Res., Volume 57 (2010), pp. 91-97

[48] G.R. Allen, M.V. Erdmann, Reef fishes of the East Indies, Volumes I-III, Tropical Reef Research, Perth, 2012.[vol. I: pp. x+1-424+end note; vol. II: pp. 425-855; vol. III: preface, map, contents and pp. 857-1260; including Appendix 1 (new species descriptions) and Appendix II (addendum).].

[49] G.I. Moore; J.B. Hutchins; M. Okamoto A new species of the deepwater clingfish genus Kopua (Gobiesociformes: Gobiesocidae) from the East China Sea – an example of antitropicality?, Zootaxa, Volume 3380 (2012), pp. 34-38

[50] J.S. Sparks; D.F. Gruber A new mesophotic clingfish (Teleostei: Gobiesocidae) from the Bahamas, Copeia (2012), pp. 251-256

[51] K.W. Conway; C.C. Baldwin; M.D. White Cryptic diversity and venom glands in Western Atlantic clingfishes of the genus Acyrtus (Teleostei: Gobiesocidae), PLoS ONE, Volume 9 (2014) no. 5, pp. 1-17 (art. e97664)

[52] R. Fricke Unguitrema nigrum, a new genus and species of clingfish (Teleostei: Gobiesocidae) from Madang, Papua New Guinea, J. Ocean Sci. Found., Volume 13 (2014), pp. 35-42

[53] R. Fricke; P. Wirtz; A. Brito Diplecogaster tonstricula, a new species of cleaning clingfish (Teleostei: Gobiesocidae) from the Canary Islands and Senegal, eastern Atlantic Ocean, with a review of the Diplecogaster-ctenocrypta species-group, J. Nat. Hist., Volume 50 (2015) no. 11–12, pp. 731-748

[54] G. Shinohara; E. Katayama A new species of the clingfish genus Kopua Gobiesociformes: Gobiesocidae) from Japan [Electronic prepublication], Ichthyol. Res. (2015), pp. 1-8

[55] M.T. Craig; S.V. Bogorodsky; J.E. Randall; A.O. Mal Lepadichthys bilineatus, a new species of clingfish from Oman (Teleostei: Gobiesocidae), with a redescription of Lepadichthys erythraeus Briggs and Link from the Red Sea, Zootaxa, Volume 3990 (2015) no. 1, pp. 113-122

[56] K.W. Conway; N.G. Bertrand; Z. Browning; T.W. Lancon; F.J. Clubb Heterodonty in the New World: An SEM investigation of oral jaw dentition in the clingfishes of the subfamily Gobiesocinae (Teleostei: Gobiesocidae), Copeia, Volume 103 (2015) no. 4, pp. 973-998

[57] R. Fricke A method of counting caudal fin rays of actinopterygian fishes, Braunschw. Naturk. Schr., Volume 1 (1983), pp. 729-733

[58] R. van der Laan; W.N. Eschmeyer; R. Fricke Family-group names of recent fishes, Zootaxa, Volume 3882 (2014) no. 2, pp. 1-230

[59] W.-J. Chen; C. Bonillo; G. Lecointre Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa, Mol. Phylogenet. Evol., Volume 26 (2003), pp. 262-288

[60] W.-J. Chen; R. Ruiz-Carus; G. Ortí Relationships among four genera of mojarras (Teleostei: Perciformes: Gerreidae) from the western Atlantic and their tentative placement among percomorph fishes, J. Fish Biol., Volume 70 (2007), pp. 202-218

[61] A. Dettaï; G. Lecointre Further support for the clades obtained by multiple molecular phylogenies in the acanthomorph bush, C. R. Biologies, Volume 328 (2005), pp. 674-689

[62] T.J. Near; A. Dornburg; R.I. Eytan; B. Keck; W.L. Smith; K.L. Kuhn; J.A. Moore; S.A. Price; F.T. Burbrink; M. Friedman; P.C. Wainwright Phylogeny and tempo of diversification in the superradiation of spiny-rayed fishes, Proc. Natl. Acad. Sci. U. S. A., Volume 110 (2013), pp. 12738-12743

[63] P.-C. Lo; S.-H. Liu; N.L. Chao; F.K.E. Nunoo; H.-K. Mok; W.-J. Chen A multi-gene dataset reveals a tropical New World origin and Early Miocene diversification of croakers (Perciformes: Sciaenidae), Mol. Phylogenet. Evol., Volume 88 (2015), pp. 132-143

[64] R.C. Edgar MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucl. Acids Res., Volume 32 (2004), pp. 1792-1797

[65] A. Rambaut, Sequence alignment editor version 1.0 a1. (1996) Available from http://evolve.zoo.ox.ac.uk/Se-Al/Se-Al.html.

[66] A. Stamatakis RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models, Bioinformatics, Volume 22 (2006), pp. 2688-2690

[67] Z. Yang Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over sites: approximate methods, J. Mol. Evol., Volume 39 (1994), pp. 306-314

[68] J. Felsenstein Confidence limits on phylogenies: an approach using the bootstrap, Evolution, Volume 39 (1985), pp. 783-791

[69] R. Fricke, W.N. Eschmeyer, Guide to fish collections in the Catalog of fishes. Online version, updated 9 August 2016, Internet publication, California Academy of Sciences, San Francisco, http://research.calacademy.org/research/Ichthyology/Catalog/collections.asp.

[70] Y. Kuroda Variability of currents off the northern coast of New Guinea, J. Oceanogr., Volume 56 (2000), pp. 103-116

[71] T. Lee; I. Fukumori; D. Menemenlis; Z.-F. Xing; L.-L. Fu Effects of the Indonesian throughflow on the Pacific and Indian Oceans, J. Phys. Oceanogr., Volume 32 (2002), pp. 1404-1429

[72] T. Hasegawa; K. Ando; K. Mizuno; R. Lukas Coastal upwelling along the north coast of Papua New Guinea and SST cooling over the Pacific warm pool: a case study for the 2002/03 El Niño event, J. Oceanogr., Volume 65 (2009), pp. 817-833

[73] A.M. Prokofiev Systematic position of Lepadicyathus mendeleevi (Teleostei: Gobiesocidae), Aktual’niie Problemii Sobremennoi Nauki, Volume 1 (2007) no. 7, pp. 181-182 ([in Russian])

[74] P.C. Wainwright; W.L. Smith; S.A. Price; K.L. Tang; J.S. Sparks; L.A. Ferry; K.L. Kuhn; R.I. Eytan; T.J. Near The evolution of pharyngognathy: a phylogenetic and functional appraisal of the pharyngeal jaw key innovation in labroid fishes and beyond, Syst. Biol., Volume 61 (2012), pp. 1001-1027

[75] J.S. Nelson; T.C. Grande; M.V.H. Wilson Fishes of the world, NJ (Wiley), Hoboken, 2016 (i–xli+1-707)

[76] H.-C. Lin; P.A. Hastings Phylogeny and biogeography of a shallow water fish clade (Teleostei: Blenniiformes), BMC Evol. Biol., Volume 13 (2013), pp. 1-18


Comments - Policy