Plan
Comptes Rendus

Molecular biology and genetics/Biologie et génétique moléculaires
Overexpression of the sweet potato IbOr gene results in the increased accumulation of carotenoid and confers tolerance to environmental stresses in transgenic potato
Comptes Rendus. Biologies, Volume 338 (2015) no. 1, pp. 12-20.

Résumé

In a previous study, we have evidenced that the overexpression of the IbOr gene isolated from sweet potato conferred a tolerance activity against salinity and methyl viologen (MV) treatment in transgenic sweet potato calli along with an enhanced carotenoid content. In this study, to further examine the function of the IbOr gene in heterologous organism, we transformed the IbOr gene into potato under the direction of SWPA2 promoter, a strong inducible promoter upon treatment with various environmental stresses. Consistently with our previous study of sweet potato calli, the level of total carotenoid was elevated up to 2.7-fold (38.1 μg g−1DW) compared to the non-transgenic control, Atlantic cultivar. However, the composition of carotenoid was not influenced by the overexpression of the IbOr gene since only pre-existing carotenoids in the non-transgenic control including violaxanthin, lutien and β-carotene were elevated at a similar level of total carotenoids. In general, the transcript levels for most of carotenogenesis-related genes were elevated in transgenic tuber, whereas they remained at similar levels in transgenic leaf tissues compared to those of non-transgenic controls. The increased levels of carotenoid content in the leaf or tuber tissue of transgenic lines were correlated with the enhanced tolerance activity against salt- or MV-mediated oxidative stresses and DPPH radical-scavenging activity. Our preliminary results suggest that further investigation is required for the development of a crop tolerant to salinity and other environmental stresses through the overexpression of the IbOr gene.

Métadonnées
Reçu le :
Accepté le :
Publié le :
DOI : 10.1016/j.crvi.2014.10.006
Mots-clés : Potato, IbOr, Carotenoid, Carotenogenesis, Antioxidant activity

Young-Min Goo 1 ; Eun-Heui Han 2 ; Jae Cheol Jeong 3 ; Sang-Soo Kwak 3 ; Jaeju Yu 4 ; Yun-Hee Kim 5 ; Mi-Jeong Ahn 6 ; Shin-Woo Lee 2

1 Sancheong Oriental Medicinal Herb Institute, Sancheong, Gyeongnam Province, Republic of Korea
2 Department of Agronomy & Medicinal Plant Resources, Gyeongnam National University of Science & Technology, JinJu, Republic of Korea
3 Plant Systems Engineering Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon, Republic of Korea
4 Department of Molecular & Cellular Biology, University of Guelph, Guelph, Ontario N1G2W1, Canada
5 Department of Biology Education, College of Education, and Institute of Agriculture and Life Science, Gyeongsang National University, Jinju, Republic of Korea
6 College of Pharmacy and Research Institute of Life Sciences, Gyeongsang National University, Jinju, Republic of Korea
@article{CRBIOL_2015__338_1_12_0,
     author = {Young-Min Goo and Eun-Heui Han and Jae Cheol Jeong and Sang-Soo Kwak and Jaeju Yu and Yun-Hee Kim and Mi-Jeong Ahn and Shin-Woo Lee},
     title = {Overexpression of the sweet potato {\protect\emph{IbOr}} gene results in the increased accumulation of carotenoid and confers tolerance to environmental stresses in transgenic potato},
     journal = {Comptes Rendus. Biologies},
     pages = {12--20},
     publisher = {Elsevier},
     volume = {338},
     number = {1},
     year = {2015},
     doi = {10.1016/j.crvi.2014.10.006},
     language = {en},
}
TY  - JOUR
AU  - Young-Min Goo
AU  - Eun-Heui Han
AU  - Jae Cheol Jeong
AU  - Sang-Soo Kwak
AU  - Jaeju Yu
AU  - Yun-Hee Kim
AU  - Mi-Jeong Ahn
AU  - Shin-Woo Lee
TI  - Overexpression of the sweet potato IbOr gene results in the increased accumulation of carotenoid and confers tolerance to environmental stresses in transgenic potato
JO  - Comptes Rendus. Biologies
PY  - 2015
SP  - 12
EP  - 20
VL  - 338
IS  - 1
PB  - Elsevier
DO  - 10.1016/j.crvi.2014.10.006
LA  - en
ID  - CRBIOL_2015__338_1_12_0
ER  - 
%0 Journal Article
%A Young-Min Goo
%A Eun-Heui Han
%A Jae Cheol Jeong
%A Sang-Soo Kwak
%A Jaeju Yu
%A Yun-Hee Kim
%A Mi-Jeong Ahn
%A Shin-Woo Lee
%T Overexpression of the sweet potato IbOr gene results in the increased accumulation of carotenoid and confers tolerance to environmental stresses in transgenic potato
%J Comptes Rendus. Biologies
%D 2015
%P 12-20
%V 338
%N 1
%I Elsevier
%R 10.1016/j.crvi.2014.10.006
%G en
%F CRBIOL_2015__338_1_12_0
Young-Min Goo; Eun-Heui Han; Jae Cheol Jeong; Sang-Soo Kwak; Jaeju Yu; Yun-Hee Kim; Mi-Jeong Ahn; Shin-Woo Lee. Overexpression of the sweet potato IbOr gene results in the increased accumulation of carotenoid and confers tolerance to environmental stresses in transgenic potato. Comptes Rendus. Biologies, Volume 338 (2015) no. 1, pp. 12-20. doi : 10.1016/j.crvi.2014.10.006. https://comptes-rendus.academie-sciences.fr/biologies/articles/10.1016/j.crvi.2014.10.006/

Version originale du texte intégral

Le texte intégral ci-dessous peut contenir quelques erreurs de conversion par rapport à la version officielle de l'article publié.

1 Introduction

Potato (Solanum tuberosum L.) is one of the four staple foods in the world and the average consumption per capita is gradually elevated since it is well known for a dietary health food. Moreover, it takes a relatively short period (about three months) for harvesting in field with a high production rate per unit acre, i.e. an annual production exceeding 300 million tons (http://faostat.fao.org). However, potato is known to be vulnerable to several environmental stresses, such as drought and high temperatures. Even short periods of stress with high temperature can result in the serious damage and cause a significant reduction in tuber yield [1]. Therefore, in view of global warming, developing a potato line tolerant to such environmental stresses became one of the major tasks for potato breeders. Recently, several attempts have been made at creating potato crops possessing enhanced tolerance to such environmental stresses by overexpressing genes involved in the osmotic adjustment [2,3], transcription factors for the drought-signaling pathway [4] involved in the phytohormone's metabolic pathway [5], and genes responding to oxidative stresses, such as strong light, UV, and H2O2 [6,7].

In plants, carotenoids act as a strong antioxidant, which prevents damage from various environmental stresses, including strong light, high temperature, UV, and drought. In addition, carotenoids are also a major source of vitamin A to animals and humans who are unable to synthesize by themselves [8]. Therefore, many efforts have been focused on the elevation of carotenoid contents in several important crops, including rice, maize, and potato. Various carotenogenesis-related genes have been introduced into potato for the elevation of carotenoid content in its tuber by using overexpression [9–11], co-transformation with more than two genes [12], anti-sense approach [13–15], and RNAi technology [16]. In particular, Diretto et al. [12] reported that β-carotene has been elevated up to 3600-fold in tuber compared to control by co-transformation of microorganism's CrtB, CrtI and CrtY gene encoding phytoene synthase, phytoene desaturase, and lycopene β-cyclase, respectively. Most of the previous works for the elevation of the carotenoid content have been focused on the accumulation in sink tissue, tuber for the improvement of nutritional quality, but much less attention has been given to the leaf tissues for the development of enhanced tolerance against various environmental stresses.

In 2002, Davison et al. [17] reported that the overexpression of β-carotene hydroxylae enhanced the stress tolerance in Arabidopsis. They proposed that the enhanced stress tolerance was due to the increased size of the xanthophyll cycle pool, the reversible interconversion of two carotenoids, violaxanthin and zeaxanthin, which play a key photoprotective role in plants [18]. The transgenic plants were more tolerant to high light and high temperature, exhibiting reduced necrosis and lipid peroxidation. It was also reported that the overexpression of bacterial β-carotene hydroxylase gene (crtZ) involved in the conversion step of β-carotene and β-cryptoxanthin to zeaxanthin significantly enhanced UV tolerance in tobacco by elevating the zeaxanthin content [19]. Based on this observation, it was suggested that the enhanced functional xanthophylls cycle pool by the overexpression of crtz gene played a major role for the increased tolerance to UV stress and damage. In transgenic sweet potato calli, the silencing of the β-carotene hydroxylase (CHY-β) gene also showed a significantly enhanced tolerance to salt meditative oxidative stress along with higher levels of β-carotene [20]. Moreover, the silencing of another gene, lycopene ɛ-cyclase (LCY-ɛ) that is involved in the first step of the α-branch synthesis pathway of carotenoids from lycopene also resulted in the 21-fold elevated content of β-carotene in sweet potato calli and enhanced a significant tolerance to salt mediated oxidative stresses [21]. However, it is still largely unknown about the mechanism involved in the enhanced tolerance activity by the elevation of the carotenoid content.

Previously, we were able to isolate the Or gene from sweet potato and create a transgenic sweet potato calli exhibiting a 14-fold increased level of total carotenoid along with enhanced tolerance activity to salt stress through the overexpression of the Or gene [22]. Although the function of the Or gene is still largely unknown, it has been suggested that the Or gene is involved in the differentiation of proplastids or non-colored plastids into chromoplasts for carotenoid accumulation [23]. Furthermore, the microscopic examination proved that the high accumulation of carotenoid was due to the formation of chromoplasts containing carotenoid-sequestering structures [24]. In addition, Li et al. [25] reported that the elevation of the carotenoid content was effective, even during the post-harvest storage of potato tuber. Based on these previous results, it has been proposed that the manipulation of the Or gene will provide a better strategy for the enhanced carotenoid content in a storage organ like tuber than the manipulation of a specific gene involved in the metabolic pathway of carotenoids.

In this study, we tried to introduce the IbOr gene isolated from sweet potato into potato to further examine the function of the IbOr gene in the accumulation of carotenoid in a heterologous organism and observe the tolerance activity against various environmental stresses.

2 Materials and methods

2.1 Plant materials and vector construction

Potato plant (Stuberosum L. cv. Atlantic) was maintained in vitro by sub-culturing every four weeks at 23 °C under 16-h light (4000 Lux) and 8-h night conditions, as described by Goo et al. [26]. Microtubers were induced by culturing continuously in vitro without sub-culturing for longer than two months. In every transformation experiment, fresh plants were obtained from newly induced microtubers by culturing on solid MS media [27] containing 2% sucrose. A recombinant T-DNA vector was constructed by placing the IbOr gene isolated from sweet potato (GenBank accession no. HQ828087) under the direction of SWAP2 promoter, a strong oxidative stress-inducible peroxidase promoter [28] and nos terminator. For the selection of transgenic lines, a bar gene encoding the phosphinothricin acetyl transferase was placed between the CaMV35S promoter and the nos terminator.

2.2 Transformation

The explants were prepared from the leaves of fresh plants of microtubers induced from an in vitro maintained plant prior to transformation and co-cultured with Agrobacterium. tumefaciens GV3101 bearing a recombinant vector as previously described [29,30]. Briefly, after co-cultivation with A. Tumefaciens carrying recombinant vector, they transferred on a regeneration medium (MS salts, sucrose 30 g/L, NAA 0.01 mg/L, zeatin 2.0 mg/L, GA3 0.1 mg/L, carbenicillin 500 mg/L) and maintained until the regeneration of shoots. Regenerated shoots were then placed on the selection media containing MS salts plus sucrose 30 g/L, phosphionthricin (PPT) 0.5 mg/L, carbenicillin 250 mg/L until rooting. When it is necessary, a higher concentration of PPT (up to 2.0 mg/L) was tried to enhance the fidelity of the transformation before molecular characterization.

2.3 Nucleic acid extraction, polymerase chain reaction (PCR) and reverse transcriptase (RT)-PCR

Genomic DNA from regenerated plants was isolated with GeneAll®Exgene™ Plant SV kit (Seoul, Korea) as described in the handbook provided. PCR was carried out with purified genomic DNA and primer set for the IbOr gene indicated in Table 1. A primer set for bar gene was designed as follow: 250F, 5′-CGGTCTGCACCATCGTCAACC-3′ and 251R, 5′-GTCCAGCTGCCAGAAACCCAC-3′. To purify total RNA from the plant, leaves or tubers were macerated in liquid N2, and Trizol reagent (Invitrogen, California, USA) was used to extract RNA, as described in the manufacturer's protocol, which was further purified with RNeasy Plant Mini kit (Qiagen, Germany). cDNA was synthesized with a kit (Toyobo, ReverTra Ace®-αE-, Osaka, Japan). PCR and RT-PCR products were fractionated on 1.5% agarose gel.

Table 1

Summary of transgenic plant.

Vector No. of explants (A) No. of regenerated shoots No. of resistant plant in PPT (1.0 mg/L) No. of transgenic plants (PCR) No. of transgenic plants (RT-PCR) (B) Transformation efficiency
(B/A × 100)
SWAP2:IbOr:pPZP-Bar 426 210 39 23 23 5.4%

2.4 Quantitative real time-PCR (qRT-PCR)

Purified total RNA from either leaf or microtuber of potato plants maintained in vitro was used to qRT-PCR for the detection of transcript levels. The reaction was carried out by using an Mx300P qPCR system (Agilent Tech. CA, USA) as described in the instruction manual provided. Briefly, 200 ng of cDNA template were mixed with 10 pmol of each specific primer set and iTaq™ Universal SYBR®Green Supermix (Bio Rad, CA, USA) and adjusted to a final reaction volume of 20 μL. Then, it was initially denatured at 95 °C for 10 min and followed by 30 cycles of 30 s at 95 °C, 30 s at 58 °C, 1.0 min at 72 °C. At the end of the 30th cycle, it was extended at 72 °C for 10 min. Actin gene was used as an internal control for normalization. The relative expression levels of carotenogenesis-related genes were calculated using the 2−ΔCT method, as described in the instruction manual provided by Agilent Tech. (CA, USA). All data are the means of three replicates from at least three individual experiments.

2.5 Carotenoid analyses

To analyze the composition of carotenoids, HPLC analyses were carried out as previously described [31–33]. Briefly, 250 mg of the lyophilized samples were homogenized in a pre-chilled mortar and a pestle with 15 mL of acetone (0.01% butylated hydroxytoluene, BHT), sea sand, Na2SO4, and NaHCO3. The solution was transferred to a 15-mL conical tube and sonicated three times for 10 min. The extract was centrifuged at 7000 rpm, 4 °C for 10 min (Eppendorf 5430R, Germany), and 5 mL of the supernatant were dried under a flow of N2 gas and dissolved in 500 μL of a CH2Cl2:acetone mixture (1:1, v/v). This sample solution was filtered through a 0.45-m membrane filter (Whatman, PTFE, 13 mm) prior to HPLC analysis.

The Agilent 1100 HPLC system (Hewlett-Packard, Waldbronn, Germany) consisted of a temperature controlled autosampler, column oven and binary pump. A 20-μL volume of standard or sample solutions was directly injected in a YMC C30 carotenoid column (3 μm, 4.6 × 250 mm, Japan) with solvent A [methanol-tert-butylmethyl ether:water (81:15:4, v/v)] and solvent B [methanol-tert-butylmethyl ether:water (6:90:4, v/v)], using a step gradient elution of 100% A for the first 10 min, then 100% A to 100% B for the next 35 min. A conditioning phase (45–50 min) was used to return the column to its initial state. The flow rate was 0.7 mL/min and the column temperature was set at 25 °C. The eluent was detected with a UV–visible detector at 450 nm. The Chemstation software (Hewlett-Packard, Avondale, CA, USA) was used to monitor the HPLC-DAD system.

Carotenoids were quantified using an external calibration method. One milligram of each standard was dissolved in 10 mL of dichloromethane, containing 0.01% BHT. Working calibration solutions (50, 20, 10, 5.0, 2.5, 1.0, 0.50, 0.25, 0.10 and 0.025 μg/mL) were prepared by diluting the stock solution of the external standard. Standards of violaxanthin, lutein, all-trans-β-carotene and 9Z-β-carotene were purchased from CaroteNature GmbH, Lupsingen, Switzerland. In these chromatographic conditions, standard carotenoids gave peaks at the following tR (min): 13.2 for violaxanthin, 24.1 for lutein, 39.6 for all-trans-β-carotene and 40.9 for 9Z-β-carotene. Methanol, water and tert-butylmethyl ether used in the HPLC system were all of HPLC grade and the other chemicals were extra grade.

2.6 Stress treatment and analyses of tolerance activity

Transgenic plants and non-transgenic control plants were grown for four weeks on MS solid media containing 3.0% sucrose and microtubers were induced as previously described. For the treatment of NaCl- or MV-mediated oxidative stress, the leaf and sliced microtuber (200 mg) was treated with 300 mM of NaCl for 24 h and 3.0 μM of methyl viologen (MV) dissolved in 0.4% sorbitol for 24 and 48 h, as previously described [7,21]. To measure the tolerance to MV-mediated oxidative stresses, NaCl treated tissues were incubated in a solution containing 1 mg/mL of 3,3-diaminobenzidine (DAB)-HCl (pH 3.8) for 5 h at 25 °C under continuous light, as described by Chadwick et al. [34] and Kim et al. [22]. The percentage of ion leakage by MV treatment was assessed using an electrical conductivity meter (Thermo Scientific Orion 3Star conductivity Benchtop, Maltham, MA, USA) at a specified time point, 24 and 48 h. At the end of the specified time period, the samples were autoclaved for 15 min at 121 °C to release all of the solutes and the conductivity were re-measured for the calculation of relative ion leakage based on this value at each time point. The radical-scavenging activity of 1,1-diphenyl 2-picrylhyorazyl (DPPH) was assessed as previously described, with slight modification [22,35]. Briefly, 200 mg of leaf or sliced microtuber tissues were ground MeOH and centrifuged at 15,000 g for 5 min. An aliquot of supernatant (100 μL) was mixed with 750 μL 0.5 mM DPPH in MeOH and shaken vigorously, left in the dark at room temperature for 30 min. The relative DPPH radical-scavenging activity was assessed by measuring the absorbance of the reactant at 517 nm with a spectrophotometer (Shimadzu, Kyoto, Japan). A MeOH solution was used as a blank for the measurement of absorbance.

2.7 Statistical analysis

All of the measurements for carotenoid content, tolerance activity for NaCl and MV-mediated oxidative stresses and DPPH radical-scavenging activity were repeated three times. The results are shown as the mean values with the standard deviation (SD).

3 Results

3.1 Transformation efficiency and molecular characterization

The constructed recombinant plasmid (SWAP:IbOr:pPZP-Bar) was initially transformed into A. Tumefaciens, GV3101 and then into potato by co-culturing with explants prepared from fresh shoot of newly induced microtubers. In total, 426 explants were co-cultured to regenerate shoots and selected on the media containing 1.0 mg/L of PPT through several individual experiments. Out of 39 plants that survived on the selection media containing PPT, 23 individual plants confirmed that the recombinant T-DNA construct was successfully inserted into their genome by using PCR and RT-PCR (Table 1). The frequency of transgenic plants was 5.4% and as shown in Fig. 1, in all plants, both IbOr and bar gene fragments were detected by PCR and their transcripts were also detected by RT-PCR, but not the negative control plant, non-transgenic plant, Atlantic cultivar, suggesting that the IbOr gene is successfully integrated into the genome of potato and actively transcribed under the stress inducible promoter, SWAP2.

Fig. 1

Results of PCR and RT-PCR for the confirmation of transgenic potato plants bearing the IbOr gene. A. Genomic DNA was purified from candidate transgenic potato plants and PCR was carried out with primer sets for IbOr or bar gene as described in Materials and methods. B. Total RNA was purified from candidate transgenic potato plants and RT-PCR was carried out with primer sets for IbOr, bar and actin, as described in Materials and methods. PCR and RT-PCR products were fractionated on 1.5% agarose gel. M: size marker; N: negative control, non-transgenic parental line, Atlantic cultivar; P: positive control. Masquer

Results of PCR and RT-PCR for the confirmation of transgenic potato plants bearing the IbOr gene. A. Genomic DNA was purified from candidate transgenic potato plants and PCR was carried out with primer sets for IbOr or bar ... Lire la suite

3.2 Enhanced level of carotenoids content in transgenic potato overexpressing IbOr

To select transgenic plants accumulating higher content of carotenoids, we then performed HPLC analyses with harvested microtubers from transgenic lines confirmed by molecular analyses. As summarized in Table 2, three individual transgenic lines, SOR3, SOR45 and SOR46 were selected, since they accumulated higher contents of carotenoids than that of the non-transgenic control cultivar. In detail, SOR46 line accumulated the highest content of total carotenoid (about 38.1 μg g−1 DW), 2.7-fold increased level compared to that of non-transgenic control cultivar. When calibrated with each peak of external standard carotenoid, violaxanthin, lutein, and β-carotene were enhanced up to 2.4- to 3.2-fold, whereas 9Z-β-carotene, 13Z-β-carotene, α-carotene, zeaxanthin, and cryptoxanthin were not detected at all, even in the non-transgenic control. The other two individual transgenic lines, SOR3 and SOR45 also exhibited 1.4- to 2.1-fold elevated total carotenoid content, and violaxanthin, lutein and β-carotene were increased at similar level but the other five carotenoids measured in this study were not detected at all. Our results indicate that the overexpression of the IbOr gene does not influence the accumulation pattern of pre-existing carotenoids in the non-transgenic control plant, but only enhance the levels of carotenoid that are already present in the non-transgenic control, although the expression of the IbOr gene was directed under the stress-inducible promoter.

Table 2

Carotenoid content and composition in micro-tuber of transgenic potato overexpressing IbOr gene measured by HPLC analyses.

Line Violaxanthin Lutein β-Carotene 9Z-β-Carotene
13Z-β-Carotene
α-Carotene,
zeaxanthin,
cryptoxanthin
Others Total
Tuber
 Atlantic 7.5 ± 1.1 3.2 ± 0.3 1.2 ± 0.0 ND ND 2.1 ± 0.2 13.9 ± 1.6
 SOR3 10.5 ± 1.6 5.6 ± 0.9 1.7 ± 0.1** ND ND 2.5 ± 0.2 20.0 ± 2.7*
 SOR45 16.8 ± 0.2** 9.2 ± 0.0** 2.4 ± 0.0** ND ND 1.4 ± 0.0* 29.7 ± 0.2**
 SOR46 23.6 ± 0.6** 10.0 ± 0.2** 2.7 ± 0.1** ND ND 1.8 ± 0.3 38.1 ± 0.9**

* P <0.05.

** P < 0.01

3.3 Effect of IbOr overexpression on the transcript levels of carotenogenesis-related genes in transgenic potato

We then examined the transcript levels of 11 genes that are involved in the complicated carotenoid biosynthetic pathway by using qRT-PCR from three individual transgenic lines, SOR3, SOR45, and SOR46. Specific primer sets for each gene's amplification were designed from the information as described in Table 3 and the results obtained by qRT-PCR were normalized against internal control, actin's transcript level and summarized as shown in Fig. 2. The IbOr gene was actively transcribed in all transgenic lines, while no transcript was detected in the non-transgenic control, Atlantic. In general, the transcript levels of 11 genes were higher in tubers than in leaves. In tuber, the expression levels for most of genes were elevated compared to the non-transgenic control, Atlantic, while most of genes were maintained at similar levels in leaves, except the Zep gene. In detail, the transcript level of Zep was most dramatically increased in both leaf and tuber tissues (up to 1.6-fold in leaves and 5.6-fold in tuber). The transcript levels of Psy2, PDS, ZDS, Crtlso, Lcy-e, and Zep in SOR46, which accumulated the highest level of carotenoids, were elevated up to 6.0, 4,6, 5.6, 8.0, 6.0 and 14.8-fold, respectively.

Table 3

Primers used for qRT-PCR analyses of carotenogenesis-related genes in transgenic potato overexpressing the IbOr gene.

Gene name Accession number Direction Primer sequences 5′–3′ Amplicon
Tm (°C)
Amplicon length (bp)
Or HQ828087 For GGAAGAGGTTCGTAGGCTGA 53.2 106
Rev CAGGTTAGGGTTCTGGGATTT 53.5
Actin J01298.1 For GGCTGGATTTGCTGGTGATG 57.4 140
Rev CCGCCTGAATAGCAACATAC 52.1
Psy1 TC122598 For CGGTCTGCTATTGTTGCTACTCC 56.7 141
Rev CAGGAACAGGTATGTCTGGCTTC 56.4
Psy2 L23424 For AGCTTTAGATAGGTGGGAGGCA 55.8 162
Rev CAAGTCCATACGCATTCCTTCAA 57.7
PDS AY484445 For AGAGACTTTGCATGCCGATTGT 57.4 151
Rev AAAGCATCGCCCTCAACTGT 55.9
ZDS TC114158 For TTGCCATGTCAAAGGCCA 55.3 141
Rev ACAGGCACTCCGACCAATTT 55.6
Crtlso TC117194 For TTGGCAGCAGTAGGACGTAAAC 55.8 151
Rev TCCCTTCCTTTTCATGTGGAA 55.6
Lcy-e AF321537 For GCCAAAATGGATGTGGCAG 55.9 151
Rev CAATGTTGCACCAGTAGGATCAG 55.9
Lut1 TC117729 For CGTTCTCCGCCCAAAAAAC 56.7 140
Rev TTGGCCTAAAGTAAGTGACCTGG 56.2
Lcy-b X86452 For AATGGGTGGTCCACTTCCAGTA 56.8 76
Rev GGATGGATGAACCATGCCAG 57.1
Chy1 TC36005 For CTTGGCCCAAAACCCACTT 56 152
Rev CCTCAAATTGAGGTTTCAGCTTCT 56.8
Chy2 TC32024 For TTTTGCTGTCTCGAAGAAAGCC 57.3 148
Rev AGCCAACAGGCAGCTAAACTCT 56.1
ZEP EST724320
(K278242)
For TCATGAATGCTGGCTGCATC 56.6 151
Rev TGCTGCAAAGTCATGCGG 56.2
Fig. 2

Expression profile of various genes involved in the carotenoid biosynthetic pathway in transgenic potato overexpressing the IbOr gene measured by using qRT-PCR. Values are the means ± SD of three replicates from at least three individual microtubers or leaves. Atlantic is the parental recipient potato cultivar; the non-transgenic control and SOR series are transgenic potato lines. Act, actin; Or, IbOr; Psy, phytoene synthase; PDS, phytoene desaturase; ZDS, ζ-carotene desaturase; Crtlso, carotene isomerase; Lcy-e, lycopene ɛ-cyclase; Lut1, α-carotene hydroxylase; Lcy-b, lycopene β-cyclase; Chy, β-carotene hydroxylase; Zep, Zeaxanthin epoxidase. Masquer

Expression profile of various genes involved in the carotenoid biosynthetic pathway in transgenic potato overexpressing the IbOr gene measured by using qRT-PCR. Values are the means ± SD of three replicates from at least three individual microtubers or leaves. Atlantic is ... Lire la suite

3.4 Enhanced antioxidant activity and salt tolerance in IbOr transgenic potato plants

To evaluate the tolerance to antioxidants, the three individual transgenic lines (SOR3, SOR 45 and SOR 46) and non-transgenic control were grown in vitro for four weeks and microtubers were induced. For the measurement of tolerance to oxidative stress induced by salt, leaves and sliced microtuber discs (about 1.0 mm in thickness) were placed on MS solid media containing 300 mM NaCl for 24 h. When the cellular H2O2 content from NaCl-treated tissues was measured by calculating the oxidized DAB content after reaction in the DAB solution, both leaves and tuber tissues of three transgenic lines exhibited less amounts of oxidized DAB compared to those of the non-transgenic cultivar (Fig. 3A). In particular, in microtubers of the SOR46 line, the oxidized DAB amount was reduced up to 50%. We also measured DPPH radical-scavenging activity to further examine the enhanced antioxidant activity. All three transgenic lines showed enhanced activity in leaf as well as microtuber compared to the non-transgenic control, Atlantic. In detail, the leaf tissue of SOR46 line exhibited 2.4-fold enhanced activity while 1.3-fold enhanced activity was examined in microtubers (Fig. 3B). To measure the tolerance activity to MV-mediated oxidative stress, sliced microtuber and leaf discs were prepared from three transgenic lines and non-transgenic control and then treated with 3.0 μM MV in 0.4% sorbitol solution. The relative ion leakage was measured after treatment with MV, in which a typical ROS-generating redox-active compound is present. Compared to non-transgenic control plants, three transgenic lines also showed a lesser level of ion leakage in leaf as well as microtuber discs upon treatment with MV, indicating that the membranes in transgenic lines were less damaged that those of control plants. As expected by the elevated tolerance activity upon treatment with NaCl-mediated oxidative treatment, SOR46 line showed the lowest level of ion leakage in both leaf and microtuber discs at 24 and 48 h after MV treatment (Fig. 3C).

Fig. 3

Tolerance activity against salt-mediated oxidative stress (A), MV-mediated oxidative stress (C and D) and DPPH radical-scavenging activity on non-transgenic (Atlantic) and transgenic potato (SOR series) overexpressing the IbOr gene. Leaf or tuber tissues were treated with NaCl (300 mM) for 24 h in the dark and their oxidation was measured by adding a DAB solution. The relative DPPH radical-scavenging activity was measured from a methanol extract of leaf or tuber tissues by adding a DPPH solution. MV (3.0 μM) in 0.4% sorbitol was treated on leaf or tuber tissues for 24 and 48 h in the dark and ion leakage was measured with EC meter. Values are the means ± SD of three replicates from at least three individual microtubers or leaves. Atlantic is the parental recipient potato cultivar; the non-transgenic control and SOR series are transgenic lines. Masquer

Tolerance activity against salt-mediated oxidative stress (A), MV-mediated oxidative stress (C and D) and DPPH radical-scavenging activity on non-transgenic (Atlantic) and transgenic potato (SOR series) overexpressing the IbOr gene. Leaf or tuber tissues were treated with NaCl (300 mM) for ... Lire la suite

4 Discussion

In this report, we were successfully able to create several transgenic potato plants (S. Tuberosum L. Cv. Atlantic) overexpressing IbOr gene under the direction of a stress inducible promoter, SWAP2. Initially, 39 individual transgenic plants were confirmed by PCR and RT-PCR that the recombinant T-DNA was successfully introduced into the genome of potato and actively transcribed. The final transformation frequency for Atlantic cultivar was about 5.4% (Table 1) and it was less than that of Jowon cultivar (12.5%) previously reported [26], indicating that the transformation frequency of potato is dependent on genotypes.

HPLC analyses showed that three individual transgenic lines SOR3, SOR45, and SOR46 accumulated elevated contents of carotenoid compared to non-transgenic controls. Although the total carotenoid levels of these transgenic lines were elevated, the pattern of carotenoid composition was not changed. Non-transgenic control, Atlantic cultivar, parental recipient line for transformation accumulated violaxanthin, lutein, and β-carotene in its tuber but 9Z-β-carotene, 13Z-β-carotene, α-carotene, zeaxanthin, and β-cryptoxanthin were not detected at all. Only three carotenoids pre-existing in the non-transgenic cultivar, Atlantic, were elevated by the overexpression of IbOr gene in transgenic lines, but not the other five carotenoids examined in this study (Table 2). Our preliminary results were consistent with a previous report on the transgenic sweet potato calli overexpressing IbOr gene [22]. In sweet potato, α-carotene, zeaxanthin, lutein, β-carotene, and β-cryptoxanthin were already present in the non-transgenic controls and they were the only elevated carotenoids by overexpression of the IbOr gene. Interestingly enough, violaxanthin was not detected in non-transgenic sweet potato, whereas zeaxanthin was not present in non-transgenic potato control, Atlantic cultivar. These preliminary results were also consistent with previous observation in transgenic potato overexpressing the Or gene isolated from cauliflower by Lopez et al. [24]. They also found that the overexpression of the Or gene under the tuber-specific promoter, granule-bound starch synthase (GBSS) increased the levels of mainly violaxanthin, lutein and β-carotene, which were present in the non-transgenic potato tuber.

It was reported that the Or gene encodes a protein-like molecular chaperon involving the differentiation of chromoplast from non-colored plastids, and provides a metabolic sink to sequester carotenoids [23]. However, the detailed mechanisms are largely unknown. To further examine the function of the Or gene in the metabolism of carotenoids in heterologous organism, we looked into the transcription levels of carotenogenesis-related genes in transgenic plants. Most of genes including Psy, Pds, Zds, Crtlso Lcy-e and Zep accumulated higher levels of transcript in the tuber of transgenic plants compared to non-transgenic controls. Noticeably, the transcript level of Zep in tuber of SOR 46 line in which accumulated the highest content of total carotenoid was elevated up to 14.8-fold compared to non-transgenic controls. Interestingly, the content of violaxanthin that is converted from zeaxanthin by Zep was also elevated up to 3.2-fold. However, in leaves, most of genes examined in this study exhibited similar levels of transcripts compared to non-transgenic control (Fig. 2). Previous reports also found that the overexpression of the Or gene did not show a specific effect on inducing the expression of any particular gene in the transgenic potato tuber [24]. Instead, higher expression levels of several genes were observed as our results. In contrast, transgenic sweet potato calli accumulated increased levels of transcripts for most of the genes involved in carotenoid biosynthetic pathway as well as NCED involved in ABA biosynthesis and Pftf involved in chromoplast differentiation [22]. In particular, the Pftf gene showed a significant increase in transcript levels and strongly suggested that the increased level of carotenoid conferred by the overexpression of IbOr gene is due to an increased driving force in sink strength rather than to an increased expression of endogenous carotenoid biosynthetic pathway. Further research is still required to examine the function of Or in the differentiation of chromoplasts.

A metabolic engineering strategy to increase the content of violaxanthin and zeaxanthin for the enhancement of stress tolerance has already been suggested, since two carotenoids are involved in the xanthophyll cycle, which is a key photoprotective mechanism in plants [17,18]. The xanthophyll cycle is the reversible interconversion between zeaxanthin and violaxanthin, and it was suggested that it specifically protects thylakoid membrane lipids against photooxidation [18]. Therefore, we further examined the stress tolerance activity with transgenic potato lines accumulated higher content of violaxanthin along with lutein and β-carotene. In SOR46 exhibiting the highest content of carotenoids, both leaf and tuber tissues showed a significantly enhanced tolerance to NaCl and MV-mediated oxidative stress. In addition, the DPPH radical scavenging activity was also significantly increased by the overexpression of the IbOr gene (Fig. 3). Our results clearly indicated that the higher content of carotenoid including violaxanthin by IbOr gene in transgenic potato resulted in an enhanced antioxidant activity. Previous reports also suggested that increased carotenoid in transgenic sweet potato calli overexpressing IbOr gene correlated with higher DPPH radical-scavenging activity and tolerance activity against NaCl-mediated oxidative stress [22]. It was also reported that the increased carotenoid biosynthetic intermediates by genetic manipulation of genes involved in the carotenoid biosynthetic pathway combat cooperatively against reactive oxygen species to alleviate cellular damage upon various environmental stresses [20,36].

In conclusion, transgenic potato lines we developed here showed enhanced tolerance activity against salt- and MV-mediated oxidative stresses and DPPH radical-scavenging activity. Our preliminary results indicate that the manipulation of the IbOr gene is a possible strategy to develop a crop tolerant to salinity and other environmental stresses in addition to improve the nutritional quality by increasing the carotenoid content through the enhanced sink strength.

Disclosure of interest

The authors declare that they have no conflicts of interest concerning this article.

Acknowledgement

This work was supported by a grant from the Next-Generation BioGreen 21 Program (No. PJ008097), Rural Development Administration, Republic of Korea. We thank Mrs. Min-Kyung Lee for her excellent technical assistance.


Bibliographie

[1] van Loon The effect of water stress on potato growth, development and yield, Am. Potato J., Volume 58 (1981), pp. 51-69

[2] I. Stiller; S. Dulai; M. Kondrák; R. Tarnai; L. Szabó; O. Toldi; Z. Bánfalvi Effects of drought on water content and photosynthetic parameters in potato plants expressing the trehalose-6-phosphate synthase gene of Saccharomyces cerevisiae, Planta (2008), pp. 299-308

[3] M. Kondrák; F. Marincs; F. Antal; Z. Juhász; Z. Bánfalvi Effects of yeast trehalose-6-phosphate synthase 1on gene expression and carbohydrate contents of potato leaves under drought stress conditions, BMC Plant Biol., Volume 12 (2012), pp. 74-86

[4] D. Shin; S.J. Moon; S. Han; B.G. Kim; S.R. Park; S.K. Lee; H.J. Yoon; H.E. Lee; H.B. Kwon; D. Baek; B.Y. Yi; M.O. Byun Expression of StMYB1R-1, a novel potato single MYB-like domain transcription factor, increases drought tolerance, Plant Physiol., Volume 155 (2011), pp. 421-432

[5] J.W. Youm; J.H. Jeon; D. Choi; S.Y. Yi; H. Joung; H.S. Kim Ectopic expression of pepper CaPF1 in potato enhances multiple stresses tolerance and delays initiation of in vitro tuberization, Planta, Volume 228 (2008), pp. 701-708

[6] L. Tang; S.Y. Kwon; S.H. Kim; J.S. Kim; K.Y. Cho; C.K. Sung; S.S. Kwak; H.S. Lee Enhanced tolerance of transgenic potato plants expressing both superoxide dismutase and ascorbate peroxidase in chloroplasts against oxidative stress and high temperature, Plant Cell Rep., Volume 25 (2006), pp. 1380-1386

[7] M.D. Kim; Y.H. Kim; S.Y. Kwon; B.Y. Jang; S.Y. Lee; D.J. Yun; J.H. Cho; S.S. Kwak; H.S. Lee Overexpression of 2-cysteine peroxiredoxin enhances tolerance to methyl viologen-mediated oxidative stress and high temperature in potato plants, Plant Physiol. Biochem., Volume 49 (2011), pp. 891-897

[8] P.D. Fraser; P.M. Bramley The biosynthesis and nutritional uses of carotenoids, Prog. Lipid Res., Volume 43 (2004), pp. 228-265

[9] L.J.M. Ducreux; W.L. Morris; P.E. Hedley; T. Shepherd; H.V. Davies; S. Millam; M.A. Taylor Metabolic engineering of high carotenoid potato tubers containing enhanced levels of b-carotene and lutein, J. Exp. Bot., Volume 56 (2005), pp. 81-89

[10] W.L. Morris; L.J.M. Ducreux; P. Hedden; S. Millam; M.A. Taylor Overexpression of a bacterial 1-deoxy-D-xylulose 5-phosphate synthase gene in potato tubers perturbs the isoprenoid metabolic network: implications for the control of the tuber life cycle, J. Exp. Bot., Volume 57 (2006), pp. 3007-3018

[11] W.L. Morris; L.J.M. Ducreux; P.D. Fraser; C. Millam; M.A. Taylor Engineering ketocarotenoid biosynthesis in potato tubers, Met. Eng., Volume 8 (2006), pp. 253-263

[12] G. Diretto; S. Al-Babili; R. Tavazza; V. Papacchioli; P. Beyer; G. Giuliano Metabolic engineering of potato carotenoid content through tuber-specific overexpression of a bacterial mini-pathway, PLoS One, Volume 2 (2007), p. e350

[13] S. Römer; F.L. Kauder; S. Steiger; C. Adomat; G. Sandmann Genetic engineering of a zeaxanthin-rich potato by antisense inactivation and co-suppression of carotenoid epoxidation, Met. Eng., Volume 4 (2002), pp. 263-272

[14] G. Diretto; R. Tavazza; R. Welsch; D. Pizzichini; F. Mourgues; V. Papacchioli; P. Bayer; G. Giuliano Metabolic engineering of potato tuber carotenoids through tuberspecific silencing of lycopene epsilon cyclase, BMC Plant Biol., Volume 6 (2006), pp. 13-24

[15] G. Diretto; R. Welsch; R. Tavazza; F. Mourgues; D. Pizzichini; P. Beyer; G. Giuliano Silencing of beta-carotene hydroxylase increases total carotenoid and beta-carotene levels in potato tubers, BMC Plant Biol., Volume 7 (2007), pp. 11-19

[16] R. Campbell; L.J.M. Ducreux; W.L. Morris; J.A. Morris; J.C. Suttle; G. Ramsay; G.J. Bryan; P.E. Hedley; M.A. Taylor The metabolic and developmental roles of carotenoid cleavage dioxygenase 4 from potato (Solanum tuberosumL), Plant Physiol., Volume 154 (2010), pp. 656-664

[17] P.A. Davison; C.N. Hunter; P. Horton Overexpression of b-carotene hydroxylase enhances stress tolerance in Arabidopsis, Nature, Volume 418 (2002), pp. 203-206

[18] M. Hauvaux; K.K. Niyongi The violaxanthin cycle protects plants from photooxidative damage by more than one mechanism, Proc. Natl. Acad. Sci. USA, Volume 96 (1999), pp. 8762-8767

[19] T. Götz; G. Sandmann; S. Römer Expression of a bacterial carotene hydroxylase gene (crtZ) enhances UV tolerance in tobacco, Plant Mol. Biol., Volume 50 (2002), pp. 129-142

[20] S.H. Kim; Y.O. Ahn; M.J. Ahn; H.S. Lee; S.S. Kwak Down-regulation of b-carotene hydroxylase increases b-carotene and total carotenoids enhancing salt stress tolerance in transgenic cultured cells of sweet potato, Phytochem., Volume 74 (2012), pp. 69-78

[21] S.H. Kim; Y.H. Kim; Y.O. Ahn; M.J. Ahn; J.C. Jeong; H.S. Lee; S.S. Kwak Down regulation of the lycopene ɛ-cyclase gene increases carotenoid synthesis via the β-branch-specific pathway and enhances salt-stress tolerance in sweet potato transgenic calli, Physiol. Plant, Volume 147 (2013), pp. 432-442

[22] S.H. Kim; Y.O. Ahn; M.J. Ahn; J.C. Jeong; H.S. Lee; S.S. Kwak Cloning and characterization of an orange gene that increases carotenoid accumulation and salt stress tolerance in transgenic sweet potato cultures, Plant Physiol. Biochem., Volume 70 (2013), pp. 445-454

[23] S. Lu; J. Van Eck; X. Zhou; A.B. Lopez; D.M. O’Halloran; K.M. Cosman; B.J. Conlin; D.J. Paolillo; D.F. Garvin; J. Vrebalov; L.V. Kochian; H. Kupper; E.D. Earle; J. Cao; L. Li The cauliflower Or gene encodes a DNA J cysteine-rich domain-containing protein that mediates high levels of beta-carotene accumulation, Plant Cell, Volume 18 (2006), pp. 3594-3605

[24] A.B. Lopez; J. Van Eck; B.J. Conlin; D.J. Paolillo; J. O’Neill; L. Li Effect of the cauliflower Or transgene on carotenoid accumulation and chromoplast formation in transgenic potato tubers, J. Exp. Bot., Volume 59 (2008), pp. 213-223

[25] L. Li; Y. Yang; Q. Xu; K. Owsiany; R. Welsch; C. Chitchumroonchokchai; S. Lu; J. Van Eck; X.-X. Deng; M. Failla; T.W. Thannhauser The Or gene enhances carotenoid accumulation and stability during post-harvest storage of potato tubers, Mol. Plant, Volume 5 (2012), pp. 339-352

[26] Y.M. Goo; T.W. Kim; M.K. Lee; S.W. Lee Accumulation of PrLeg, a perilla legumin protein in potato tuber results in enhanced level of sulphur-containing amino acids, C. R. Biologies, Volume 336 (2013), pp. 433-439

[27] T. Murashige; F. Skoog A revised medium for rapid growth and bio-assays with tobacco tissue cultures, Physiol. Plant, Volume 15 (1952), pp. 473-497

[28] K.Y. Kim; S.Y. Kwon; H.S. Lee; Y. Hur; J.W. Bang; S.S. Kwak A novel oxidative stress-inducible peroxidase promoter from sweet potato:molecular cloning and characterization in transgenic tobacco plants and cultured cells, Plant Mol. Biol., Volume 51 (2003), pp. 831-838

[29] T.W. Kim; Y.M. Goo; C.H. Lee; B.H. Lee; J.M. Bae; S.W. Lee The sweet potato ADP-glucose pyrophosphorylase gene (ibAGP1) promoter confers high-level expression of the GUS reporter gene in the potato tuber, C. R. Biologies, Volume 332 (2009), pp. 876-885

[30] Y.M. Goo; H.J. Chun; T.W. Kim; C.H. Lee; M.J. Ahn; S.C. Bae; K.J. Cho; J.A. Chun; C.H. Chung; S.W. Lee Expressional characterization of dehydroascorbate reductase cDNA in transgenic potato plants, J. Plant Biol., Volume 51 (2008), pp. 35-41

[31] W.L. Morris; L. Ducreux; D.W. Griffiths; D. Stewart; H.V. Davies; M.A. Taylor Carotenogenesis during tuber development and storage in potato, J. Exp. Bot., Volume 55 (2004), pp. 975-982

[32] K.D. Yoon; S.N. Kang; J.Y. Bae; H.S. lee; S.S. Kwak; I. Jang; I.S. Kim; C.H. Lee; J.M. Bae; S.W. Lee; M.J. Ahn Enhanced antioxidant and protective activities on retinal ganglion cells of carotenoids-overexpressing transgenic carrot, Curr. Drug Targets, Volume 14 (2013), pp. 999-1005

[33] Y.M. Goo; T.W. Kim; S.H. Ha; K.W. Back; J.M. Bae; Y.W. Shin; C.H. Lee; M.J. Ahn; S.W. Lee Expression profiles of genes involved in the carotenoid biosynthetic pathway in yellow-fleshed potato cultivars (Solanum tuberosum L.) from South South Korea, J. Plant Biol., Volume 52 (2009), pp. 49-55

[34] C.A. Chadwick; C.S. Potten; O. Nikaido; T. Matsunaga; C. Proby; A.R. Young The detection of cyclobutane thymine dimers, (6-4) photolesions and the dewar photoisomers in sections of UV-irradiated human skin using specific antibodies, and the demonstration of depth penetration effects, J. Photochem. Photobiol. B, Volume 28 (1995) no. 1995, pp. 163-170

[35] A. Pieroni; V. Janiak; C.M. Durr; S. Ludeke; E. Trachsel; M. Heinrich In vitro antioxidant activity of non-cultivated vegetables of ethnic Albanians in southern Italy, Phytother. Res., Volume 16 (2002) no. 2002, pp. 467-473

[36] C. Rosati; R. Aquilani; S. Dharmapuri; P. Pallara; C. Marusic; R. Tavazza; F. Bouvier; B. Camara; G. Giuliano Metabolic engineering of beta-carotene and lycopene content in tomato fruit, Plant J., Volume 24 (2000), pp. 413-420


Cité par

  • Mingku Zhu The unique importance of sweetpotato: Insights focusing on genetic improvements of salt and drought tolerance, Scientia Horticulturae, Volume 339 (2025), p. 113848 | DOI:10.1016/j.scienta.2024.113848
  • Xiaoqing Meng; Tingting Dong; Zongyun Li; Mingku Zhu First systematic review of the last 30 years of research on sweetpotato: elucidating the frontiers and hotspots, Frontiers in Plant Science, Volume 15 (2024) | DOI:10.3389/fpls.2024.1428975
  • Sujatha Thankeswaran Parvathy; M. N. Sheela Genetic Modification of Tropical Root and Tuber Crops: Prospects and Perspectives, Genetic Engineering of Crop Plants for Food and Health Security (2024), p. 119 | DOI:10.1007/978-981-97-3119-0_6
  • Zagipa Sapakhova; Zhanar Abilda; Maxat Toishimanov; Dias Daurov; Ainash Daurova; Nurgul Raissova; Alexander Sidorik; Rakhim Kanat; Kabyl Zhambakin; Malika Shamekova Early Generation Selection of Potato Breeding Lines, Horticulturae, Volume 10 (2024) no. 10, p. 1121 | DOI:10.3390/horticulturae10101121
  • Smita Agrawal; Amit Kumar; Yash Gupta; Ayushi Trivedi Potato Biofortification: A Systematic Literature Review on Biotechnological Innovations of Potato for Enhanced Nutrition, Horticulturae, Volume 10 (2024) no. 3, p. 292 | DOI:10.3390/horticulturae10030292
  • Sulaiman Ahmed; Muhammad Saad Shoaib Khan; Songlei Xue; Faisal Islam; Aziz Ul Ikram; Muhammad Abdullah; Shan Liu; Piengtawan Tappiban; Jian Chen A comprehensive overview of omics-based approaches to enhance biotic and abiotic stress tolerance in sweet potato, Horticulture Research, Volume 11 (2024) no. 3 | DOI:10.1093/hr/uhae014
  • Moemen S. Hanafy; Abeer F. Desouky; Mohsen S. Asker; Eman R. Zaki Impact of homologous overexpression of PR10a gene on improving salt stress tolerance in transgenic Solanum tuberosum, Journal of Genetic Engineering and Biotechnology, Volume 22 (2024) no. 4, p. 100437 | DOI:10.1016/j.jgeb.2024.100437
  • Sagar S. Datir; Sharon Regan Transgenic Approaches for Nutritional Enhancement of Potato, Advances in Root Vegetables Research (2023) | DOI:10.5772/intechopen.106898
  • Ming-Hua Liang; Jv-Liang Dai; Shan-Rong Xie; Jing-Xuan Wu; Hao-Hong Chen; Jian-Guo Jiang Orange protein (DbOR) from the salt-tolerant green alga Dunaliella bardawil mediates photosynthesis against heat stress via interacting with DbPsbP1, Algal Research, Volume 72 (2023), p. 103105 | DOI:10.1016/j.algal.2023.103105
  • Yong-Jie Shan; Dan Li; Jing-Jing Cao; Li Zhang; Li-Quan Han; Mei-Ping Zhang; Zhen-Guo Shen Over-expression of Arabidopsis ORANGE gene enhances drought stress tolerance through ABA-dependent pathway in Arabidopsis thaliana, Plant Growth Regulation, Volume 96 (2022) no. 1, p. 91 | DOI:10.1007/s10725-021-00760-2
  • Chune Peng; Yi Xing; Qingbin Wang; Chenchen Wang; Xiaoying Zhang; Dayin Chen; Yunzhi Song; Changxiang Zhu Expression of Tobacco Lipid Transfer Protein NtLTP4 Enhances Tolerance to Abiotic and Biotic Stresses in Transgenic Potato Lines, Potato Research, Volume 65 (2022) no. 3, p. 631 | DOI:10.1007/s11540-021-09537-6
  • Chandrama Prakash Upadhyaya; Deepak Singh Bagri Biotechnological Approaches for Nutritional Improvement in Potato ( Solanum tuberosum L.), Genome Engineering for Crop Improvement (2021), p. 253 | DOI:10.1002/9781119672425.ch15
  • Mohammad Yazdani; Michelle G. Croen; Tara L. Fish; Theodore W. Thannhauser; Beth A. Ahner Overexpression of native ORANGE (OR) and OR mutant protein in Chlamydomonas reinhardtii enhances carotenoid and ABA accumulation and increases resistance to abiotic stress, Metabolic Engineering, Volume 68 (2021), p. 94 | DOI:10.1016/j.ymben.2021.09.006
  • Stefan M. Kolašinac; Zora P. Dajić Stevanović; Sofija N. Kilibarda; Aleksandar Ž. Kostić Carotenoids: New Applications of “Old” Pigments, Phyton, Volume 90 (2021) no. 4, p. 1041 | DOI:10.32604/phyton.2021.015996
  • Xiongjie Zheng; Giovanni Giuliano; Salim Al-Babili Carotenoid biofortification in crop plants: citius, altius, fortius, Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids, Volume 1865 (2020) no. 11, p. 158664 | DOI:10.1016/j.bbalip.2020.158664
  • Ho Soo Kim; Wenbin Wang; Le Kang; So-Eun Kim; Chan-Ju Lee; Sung-Chul Park; Woo Sung Park; Mi-Jeong Ahn; Sang-Soo Kwak Metabolic engineering of low-molecular-weight antioxidants in sweetpotato, Plant Biotechnology Reports, Volume 14 (2020) no. 2, p. 193 | DOI:10.1007/s11816-020-00621-w
  • Oussama Ahrazem; Alberto José López; Javier Argandoña; Raquel Castillo; Ángela Rubio-Moraga; Lourdes Gómez-Gómez Differential interaction of Or proteins with the PSY enzymes in saffron, Scientific Reports, Volume 10 (2020) no. 1 | DOI:10.1038/s41598-020-57480-2
  • Dorcus C. Gemenet; Guilherme da Silva Pereira; Bert De Boeck; Joshua C. Wood; Marcelo Mollinari; Bode A. Olukolu; Federico Diaz; Veronica Mosquera; Reuben T. Ssali; Maria David; Mercy N. Kitavi; Gabriela Burgos; Thomas Zum Felde; Marc Ghislain; Edward Carey; Jolien Swanckaert; Lachlan J. M. Coin; Zhangjun Fei; John P. Hamilton; Benard Yada; G. Craig Yencho; Zhao-Bang Zeng; Robert O. M. Mwanga; Awais Khan; Wolfgang J. Gruneberg; C. Robin Buell Quantitative trait loci and differential gene expression analyses reveal the genetic basis for negatively associated β-carotene and starch content in hexaploid sweetpotato [Ipomoea batatas (L.) Lam.], Theoretical and Applied Genetics, Volume 133 (2020) no. 1, p. 23 | DOI:10.1007/s00122-019-03437-7
  • Wenbin Wang; Xiangpo Qiu; Yanxin Yang; Ho Soo Kim; Xiaoyun Jia; Huan Yu; Sang-Soo Kwak Sweetpotato bZIP Transcription Factor IbABF4 Confers Tolerance to Multiple Abiotic Stresses, Frontiers in Plant Science, Volume 10 (2019) | DOI:10.3389/fpls.2019.00630
  • Wenbin Wang; Huan Yu; Ho Soo Kim; Yanxin Yang; Xiangpo Qiu; Sang-Soo Kwak Molecular characterization of a sweet potato stress tolerance-associated trehalose-6-phosphate synthase 1 gene (IbTPS1) in response to abiotic stress, Plant Biotechnology Reports, Volume 13 (2019) no. 3, p. 235 | DOI:10.1007/s11816-019-00532-5
  • So-Eun Kim; Ho Soo Kim; Zhi Wang; Qingbo Ke; Chan-Ju Lee; Sul-U Park; Ye-Hoon Lim; Woo Sung Park; Mi-Jeong Ahn; Sang-Soo Kwak A single amino acid change at position 96 (Arg to His) of the sweetpotato Orange protein leads to carotenoid overaccumulation, Plant Cell Reports, Volume 38 (2019) no. 11, p. 1393 | DOI:10.1007/s00299-019-02448-4
  • Chen Kang; Shaozhen He; Hong Zhai; Ruijie Li; Ning Zhao; Qingchang Liu A Sweetpotato Auxin Response Factor Gene (IbARF5) Is Involved in Carotenoid Biosynthesis and Salt and Drought Tolerance in Transgenic Arabidopsis, Frontiers in Plant Science, Volume 9 (2018) | DOI:10.3389/fpls.2018.01307
  • Jiwan S. Sidhu; Sudarshan Chellan Application of Genetic Engineering in Vegetable Crops, Handbook of Vegetables and Vegetable Processing (2018), p. 83 | DOI:10.1002/9781119098935.ch4
  • Mohan Sankari; Priya Rajendra Rao; Hridya Hemachandran; Phani Kumar Pullela; George Priya Doss C; Iftikhar Aslam Tayubi; Babu Subramanian; KM Gothandam; Pooja Singh; Siva Ramamoorthy Prospects and progress in the production of valuable carotenoids: Insights from metabolic engineering, synthetic biology, and computational approaches, Journal of Biotechnology, Volume 266 (2018), p. 89 | DOI:10.1016/j.jbiotec.2017.12.010
  • Ho Soo Kim; Chang Yoon Ji; Chan-Ju Lee; So-Eun Kim; Sung-Chul Park; Sang-Soo Kwak Orange: a target gene for regulating carotenoid homeostasis and increasing plant tolerance to environmental stress in marginal lands, Journal of Experimental Botany, Volume 69 (2018) no. 14, p. 3393 | DOI:10.1093/jxb/ery023
  • Yun-Hee Kim; Eun-Hee Han; Sang-Soo Kwak; Shin-Woo Lee Development of transgenic potato with improved anthocyanin contents using sweet potato IbMYB1 gene, Journal of Plant Biotechnology, Volume 45 (2018) no. 4, p. 364 | DOI:10.5010/jpb.2018.45.4.364
  • Le Kang; Sung-Chul Park; Chang Yoon Ji; Ho Soo Kim; Haeng-Soon Lee; Sang-Soo Kwak Metabolic engineering of carotenoids in transgenic sweetpotato, Breeding Science, Volume 67 (2017) no. 1, p. 27 | DOI:10.1270/jsbbs.16118
  • Giovanni Giuliano Provitamin A biofortification of crop plants: a gold rush with many miners, Current Opinion in Biotechnology, Volume 44 (2017), p. 169 | DOI:10.1016/j.copbio.2017.02.001
  • Le Kang; Ho S. Kim; Young S. Kwon; Qingbo Ke; Chang Y. Ji; Sung-Chul Park; Haeng-Soon Lee; Xiping Deng; Sang-Soo Kwak IbOr Regulates Photosynthesis under Heat Stress by Stabilizing IbPsbP in Sweetpotato, Frontiers in Plant Science, Volume 8 (2017) | DOI:10.3389/fpls.2017.00989
  • Rashidi Othman; Suhair Kamoona; Irwandi Jaswir; Parveen Jamal; Farah Ayuni Mohd Hatta Stability of Carotenoid Composition in Orange Sweet Potato (Ipomoea batatas) Tuber Flesh Over Three Growing Seasons and Months Storage Time, Journal of Pharmacy and Nutrition Sciences, Volume 7 (2017) no. 4, p. 158 | DOI:10.6000/1927-5951.2017.07.04.2
  • Judit Berman; Uxue Zorrilla-López; Vicente Medina; Gemma Farré; Gerhard Sandmann; Teresa Capell; Paul Christou; Changfu Zhu The Arabidopsis ORANGE (AtOR) gene promotes carotenoid accumulation in transgenic corn hybrids derived from parental lines with limited carotenoid pools, Plant Cell Reports, Volume 36 (2017) no. 6, p. 933 | DOI:10.1007/s00299-017-2126-z
  • Z. Qin; A. Li; F. Hou; Q. Wang; S. Dong; L. Zhang Gene identification using RNA-seq in two sweetpotato genotypes and the use of mining to analyze carotenoid biosynthesis, South African Journal of Botany, Volume 109 (2017), p. 189 | DOI:10.1016/j.sajb.2017.01.003
  • Enriqueta Alós; Maria Jesús Rodrigo; Lorenzo Zacarias Manipulation of Carotenoid Content in Plants to Improve Human Health, Carotenoids in Nature, Volume 79 (2016), p. 311 | DOI:10.1007/978-3-319-39126-7_12
  • Seyeon Park; Ho Soo Kim; Young Jun Jung; Sun Ha Kim; Chang Yoon Ji; Zhi Wang; Jae Cheol Jeong; Haeng-Soon Lee; Sang Yeol Lee; Sang-Soo Kwak Orange protein has a role in phytoene synthase stabilization in sweetpotato, Scientific Reports, Volume 6 (2016) no. 1 | DOI:10.1038/srep33563
  • Noam Chayut; Hui Yuan; Shachar Ohali; Ayala Meir; Yelena Yeselson; Vitaly Portnoy; Yi Zheng; Zhangjun Fei; Efraim Lewinsohn; Nurit Katzir; Arthur A. Schaffer; Shimon Gepstein; Joseph Burger; Li Li; Yaakov Tadmor A bulk segregant transcriptome analysis reveals metabolic and cellular processes associated with Orange allelic variation and fruit β-carotene accumulation in melon fruit, BMC Plant Biology, Volume 15 (2015) no. 1 | DOI:10.1186/s12870-015-0661-8
  • Sun Ha Kim; Myoung Duck Kim; Sung-Chul Park; Jae Cheol Jeong; Haeng-Soon Lee; Sang-Soo Kwak Development of transgenic cassava plants expressing IbOr gene by somatic embryogenesis, Journal of Plant Biotechnology, Volume 42 (2015) no. 2, p. 88 | DOI:10.5010/jpb.2015.42.2.88
  • Zhi Wang; Qingbo Ke; Myoung Duck Kim; Sun Ha Kim; Chang Yoon Ji; Jae Cheol Jeong; Haeng-Soon Lee; Woo Sung Park; Mi-Jeong Ahn; Hongbing Li; Bingcheng Xu; Xiping Deng; Sang-Hoon Lee; Yong Pyo Lim; Sang-Soo Kwak; Hiroshi Ezura Transgenic Alfalfa Plants Expressing the Sweetpotato Orange Gene Exhibit Enhanced Abiotic Stress Tolerance, PLOS ONE, Volume 10 (2015) no. 5, p. e0126050 | DOI:10.1371/journal.pone.0126050

Cité par 37 documents. Sources : Crossref


Commentaires - Politique