Plan
Comptes Rendus

Evolution/Évolution
Metallothionein primary structure in amphibians: Insights from comparative evolutionary analysis in vertebrates
[La structure primaire de la métallothionéine chez les amphibiens : de nouvelles informations à partir d’une évolution des analyses comparatives chez les vertébrés]
Comptes Rendus. Biologies, Volume 335 (2012) no. 7, pp. 480-487.

Résumé

Metallothioneins are cysteine-rich, low-molecular weight metal-binding proteins ubiquitously expressed in living organisms. In the last past years, the increasing amount of vertebrate non-mammalian metallothionein sequences available have disclosed for these proteins differences in the primary structure that have not been supposed before. To provide a more up-to-date view of the metallothioneins in non-mammalian tetrapods, we decided to increase the still scarce knowledge concerning the primary structure and the evolution of metallothioneins in amphibians. Our data demonstrate an unexpected diversity of metallothionein sequences among amphibians, accompanied by remarkable features in their phylogeny. Phylogenetic analysis also reveals the complexity of vertebrate metallothionein evolution, made by both ancient and more recent events of gene duplication and loss.

Supplementary Materials:
Supplementary material for this article is supplied as a separate file:

Métadonnées
Reçu le :
Accepté le :
Publié le :
DOI : 10.1016/j.crvi.2012.05.003
Mots-clés : Amphibia, Hydropathy, Metallothionein, Molecular evolution, Phylogeny

Francesca Trinchella 1 ; Maria Grazia Esposito 1 ; Rosaria Scudiero 1

1 Department of Biological Sciences, University of Naples Federico II, via Mezzocannone 8, 80134 Napoli, Italy
@article{CRBIOL_2012__335_7_480_0,
     author = {Francesca Trinchella and Maria Grazia Esposito and Rosaria Scudiero},
     title = {Metallothionein primary structure in amphibians: {Insights} from comparative evolutionary analysis in vertebrates},
     journal = {Comptes Rendus. Biologies},
     pages = {480--487},
     publisher = {Elsevier},
     volume = {335},
     number = {7},
     year = {2012},
     doi = {10.1016/j.crvi.2012.05.003},
     language = {en},
}
TY  - JOUR
AU  - Francesca Trinchella
AU  - Maria Grazia Esposito
AU  - Rosaria Scudiero
TI  - Metallothionein primary structure in amphibians: Insights from comparative evolutionary analysis in vertebrates
JO  - Comptes Rendus. Biologies
PY  - 2012
SP  - 480
EP  - 487
VL  - 335
IS  - 7
PB  - Elsevier
DO  - 10.1016/j.crvi.2012.05.003
LA  - en
ID  - CRBIOL_2012__335_7_480_0
ER  - 
%0 Journal Article
%A Francesca Trinchella
%A Maria Grazia Esposito
%A Rosaria Scudiero
%T Metallothionein primary structure in amphibians: Insights from comparative evolutionary analysis in vertebrates
%J Comptes Rendus. Biologies
%D 2012
%P 480-487
%V 335
%N 7
%I Elsevier
%R 10.1016/j.crvi.2012.05.003
%G en
%F CRBIOL_2012__335_7_480_0
Francesca Trinchella; Maria Grazia Esposito; Rosaria Scudiero. Metallothionein primary structure in amphibians: Insights from comparative evolutionary analysis in vertebrates. Comptes Rendus. Biologies, Volume 335 (2012) no. 7, pp. 480-487. doi : 10.1016/j.crvi.2012.05.003. https://comptes-rendus.academie-sciences.fr/biologies/articles/10.1016/j.crvi.2012.05.003/

Version originale du texte intégral

Le texte intégral ci-dessous peut contenir quelques erreurs de conversion par rapport à la version officielle de l'article publié.

1 Introduction

Metallothioneins (MTs) are metal-containing proteins that bind zinc, copper and other metallic ligands thanks to the cysteine residues of their polypeptide chain [1]. In addition to supporting homeostatic buffering of metallic micronutrients into the cells by providing Zn and Cu supply, MTs fulfil a broad range of other functions, including detoxification of toxic metals such as cadmium and mercury, scavenging of harmful reactive oxygen species, and others [2,3]. Thus it is not surprising that the versatile MTs are found from bacteria to fungi, protists, plants, and most animal groups [4,5].

In spite of many studies on MTs, little is known about their origin, evolution and diversification [6].

MT evolution is still an obscure aspect of these fascinating metal-binding proteins. The members of the MT protein superfamily have evolved through rounds of duplication and loss events leading to the current heterogeneous scenario. Difficulties in drawing straight evolutionary relationships could be in part attributed to the lack of detailed comparative studies.

Among vertebrates, a great deal of knowledge on MT structure and function relies on studies carried out on mammalian MTs. In mammals, four tandemly clustered genes (MT1 to MT4) are known. Although all genes encode for conserved peptide chains retaining 20 invariant metal-binding cysteines, MT3 and MT4 have developed additional properties relatively to MT1 and MT2, such as protection against brain injuries [7,8] and epithelial differentiation [9], respectively. In addition, the evolution of the MT1 gene in humans led to duplication events that resulted in more than 10 duplicate isoforms [10,11].

Regarding non-mammalian vertebrates, in the last past years many data were collected on the molecular, biochemical and phylogenetic characteristics of piscine and avian metallothioneins [12–18]. Recently, we performed a comparative analysis integrating phylogenetics, functional, and structural approaches, that unravelled the complex evolutionary pattern of the reptilian MT, characterized by gene duplication and gene loss events [19,20]. These data also disclosed for the vertebrate MTs an unexpected complexity in the primary structure that might suppose some functional differences in proteins.

At the moment, however, still very few data are available on the structure of the amphibian metallothioneins [21–23].

To provide a more up-to-date view of the MT genes in vertebrates, we decided to increase the number of the available amphibian MT primary sequences by using a molecular approach. Then, we derived a new vertebrate gene phylogeny taking into account also this animal group.

2 Materials and methods

2.1 Metallothionein cDNA cloning and sequencing

For this study, we cloned and sequenced the MT cDNA from the Italian crested newt Triturus carniflex (Amphibia, Urodela) and the frog Rana esculenta (Amphibia, Anura). Samples for both animals were caught in the outskirt of Naples, under the permission of the Italian Health Ministry.

Liver slices (50–100 mg) were submerged in RNAlater RNA Stabilisation Solution (Ambion) immediately after collection and stored at −20 °C until used. Tissues were homogenized in a small glass homogenizer and the total RNA was purified using the TRI-REAGENT solution (Sigma-Aldrich). The integrity of the total RNA was checked in 1% denaturing formaldehyde agarose gel. Reverse transcription (RT) was carried out using SuperScript II reverse transcriptase according to the standard protocol described by the manufacturer (Invitrogen). The RT reaction was performed at 42 °C for 60 min using the oligo(dT)-adaptor primer previously described [24]. PCR reactions were carried out on 2 μl of first-strand cDNA, using a non-specific primer complementary to the oligo(dT) adaptor and the specific 18mer Amex-Nter (ATGGACTGCGCATGCGCCACT) designed on the basis of the first 7 amino acid residues of Ambystoma mexicanum metallothionein [23]. The purified PCR products were directly cloned into the pCRII-TOPO vector and transformed into TOP10 E. coli cells using the TOPO-TA cloning kit according to the manufacturer's instructions (Invitrogen). Several randomly selected colonies were inoculated into LB broth containing 100 μg/ml ampicillin and incubated overnight at 37 °C with shaking. Plasmids containing inserted sequences were purified using Fast Plasmid columns (Eppendorf) and sequenced using automated methods on an ABI PRISM Genetic Analyzer (PE Biosystems). Sequences and annotations of these two MT cDNAs appear in the DDBJ/EMBL/GenBank database with accession numbers shown in Table 1.

Table 1

Organism, gene, accession number and acronym of the 41 sequences used for the phylogenetic analysis of the vertebrate metallothioneins.

Organism Gene name Accession No. Acronym
Mammals
Homo sapiens Metallothionein 1 P04731 H.sapMT1
Metallothionein 2 P02795 H.sapMT2
Metallothionein 3 P25713 H.sapMT3
Metallothionein 4 NP_116324 H.sapMT4
Bos taurus Metallothionein 1 P67983 B.tauMT1
Metallothionein 2 P68301 B.tauMT2
Metallothionein 3 P37359 B.tauMT3
Metallothionein 4 Q05B43 B.tauMT4
Rattus norvegicus Metallothionein 1 P02803 R.norMT1
Metallothionein 2 P04355 R.norMT2
Metallothionein 3 P37361 R.norMT3
Metallothionein 4 D3ZTJ2 R.norMT4
Canis lupus Metallothionein 1 O19000 C.lupMT1
Metallothionein 2 Q9XST5 C.lupMT2
Metallothionein 3 AB001388 C.lupMT3
Metallothionein 4 BAA87326 C.lupMT4
Birds
Phalacrocorax carbo Metallothionein 1 A4PBS7 P.carMT1
Metallothionein 2 A4PBS8 P.carMT2
Anas platyrhynchos Metallothionein 1 A4PBS9 C.livMT1
Metallothionein 2 P68494 C.livMT2
Gallus gallus Metallothionein 1 A4PBT0 G.galMT1
Metallothionein 2 P68497 G.galMT2
Reptiles
Anguis fragilis Metallothionein AM087390 A.fraMT
Chalcides chalcides Metallothionein AM087392 C.chaMT
Phelsuma barbouri Metallothionein AM087397 P.barMT
Podarcis sicula Metallothionein AJ609541 P.sicMT
Elaphe quatorlineata Metallothionein AM087393 E.quaMT
Furcifer pardalis
Metallothionein AM087394 F.parMT
Amphibians
Ambystoma mexicanum Metallothionein AF008583 A.mexMT
Xenopus laevis Metallothionein Q05890 X.laeMT
Xenopus tropicalis Metallothionein NP_001165150 X.troMT
Rana esculenta Metallothionein HE681912 R.escMT
Triturus carniflex Metallothionein HE681911 T.carMT
Osteichthyes
Chionodraco hamatus Metallothionein I Y12580 C.hamMT1
Metallothionein II Y12581 C.hamMT2
Trematomus bernacchii Metallothionein I AJ011585 T.berMT1
Metallothionein II Z72485 T.berMT2
Gymnodraco acuticeps Metallothionein I AJ007560 G.acuMT1
Metallothionein II AJ007561 G.acuMT2
Danio rerio Metallothionein I NM131075 D.rerMT1
Metallothionein II NM194273 D.rerMT2

2.2 Multiple alignments and sequences analyses

Sequences of vertebrate MTs were retrieved from the NCBI database. The accession numbers of the selected sequences are reported in Table 1. Multiple alignments of MT amino acid sequences were obtained using the program MUSCLE version 3.8 [25]; the amphibian MT coding sequences plus the 3′-UTRs were aligned by the same program. All the alignments used for the phylogenetic analyses were refined manually by the program Se-Al v. 20a11.

The average hydropathic index for each protein sequence was calculated as previously described [15].

2.3 Phylogenetic analyses

Phylogenetic trees were inferred by Maximum Likelihood (ML) model. Analyses were performed with SeaView version 4 software [26], using the Dayhoff + I + G (Invariant sites and Gamma-distributed rates for sites) substitution model following the results from ProtTest for the amino acid sequences [27] and the Generalised Time Reversible (GTR) model following the results from ModelTest for the amphibian MT nucleotide sequences [28]. Bootstrap branch support was estimated using 1000 data sets. Trees visualization and final edition were performed in FigTree v1.3.1.

3 Results

3.1 Characteristics of amphibian metallothioneins

In order to increase the number of known primary structures of the amphibian MT, we cloned and sequenced the cDNA encoding the MT from two species belonging to the class Amphibia: the Salamandrinidae T. carniflex and the Raninae R. esculenta. The MT cDNA fragment obtained by PCR from the hepatic total RNA of the urodelian T. carniflex contains an open reading frame of 189 bp plus a 3′-UTR made of 155 bp; the predicted amino acid sequence corresponds to a protein of 63 amino acids, 20 of them being cysteines. The R. esculenta MT cDNA fragment is of 308 bp, with a coding sequence of 186 bp corresponding to a protein of 62 amino acids with 20 cysteines.

The multiple alignment of these two new nucleotide sequences with the other amphibian MT sequences available is reported in the Fig. 1. Noteworthy, the alignment shows the presence of gaps in the coding sequence region and marked differences in the length of the 3′-UTR sequences, that vary from 641 bp for the A. mexicanum sequence to 122 bp for the R. esculenta MT.

Fig. 1

Alignment of the five available amphibian MT nucleotide sequences. Grey box indicates termination codons; asterisks indicate identity among sequences. The GenBank accession numbers of these sequences are reported in Table 1.

The alignment of the deduced amino acid sequences of the amphibian MTs although reveals a good degree of overall similarity among sequences (about 70%), at the same time shows significant differences (Fig. 2). Anuran MTs share the same number of amino acid residues (62), however only Xenopus MT is characterized by the presence of a histidine residue, typical of avian MTs. The two urodelian MTs show an unexpected diversity between each other: T. carniflex MT is made of 63 amino acids, A. mexicanum MT of only 60 amino acids, as piscine MTs.

Fig. 2

Alignment of the amphibian MT proteins deduced from the nucleotide sequences reported in Fig. 1.

3.2 Phylogeny of amphibian metallothioneins

The phylogeny of MTs from amphibians was reconstructed with the maximum likelihood method. A phylogenetic tree was constructed using as dataset the amino acidic sequences, and another tree was constructed using as dataset the nucleotide sequences, including the 3′-UTRs. The 3′-non coding regions are highly variable, thus carry more phylogenetic information with respect to MT coding sequences that have a low phylogenetic resolution, due to their relatively short length and low variability. Both the inferred trees show the same topology (Fig. 3), supported by high values of bootstrap analysis. This topology clearly shows a marked incongruence with the phylogeny of extant Amphibia [29].

Fig. 3

Phylogenetic tree of the amino acid sequences of the amphibian MT inferred by the Maximum Likelihood method using the Dayhoff + I + G substitution model implemented in the software SeaView v. 4.0. The same topology was obtained by using as dataset the nucleotide sequences (coding sequences plus the 3′-UTRs) of the amphibian MT object of the present study and the GTR as substitution model. The numbers at the branches represent the bootstrap values (1000 replicates); in parentheses bootstrap values obtained using the nucleotide sequences. Masquer

Phylogenetic tree of the amino acid sequences of the amphibian MT inferred by the Maximum Likelihood method using the Dayhoff + I + G substitution model implemented in the software SeaView v. 4.0. The same topology was obtained by using as dataset the nucleotide sequences ... Lire la suite

3.3 Phylogeny of vertebrate metallothioneins

Forty-one amino acid sequences representative of the major classes of vertebrates were aligned (Supplementary Fig. 1) and used to derive new insights on the evolutionary history of vertebrate MTs. The accession numbers of the final set of sequences are listed in Table 1. The maximum likelihood tree is shown in Fig. 4. The ML analysis identified two major clades, one of piscine MTs and another comprising MTs of tetrapods. In turn, the latter is divided in two clades, one of which, made of avian MT1 and mammalian MT4 isoforms, emerges basal to the other groups of tetrapod MTs. The phylogeny of the MT isoforms in mammals clearly demonstrates that among them the MT4 isoform is the most ancestral form, whereas the MT1/MT2 isoforms are the most divergent. Finally, the MT3 clusters forming a sister group of the avian MT2/reptilian MT clade. Noteworthy, the topology of amphibian MT cluster is not perfectly equivalent to the topology inferred when the sequences are analysed alone (Fig. 3).

Fig. 4

Phylogenetic tree of the amino acid sequences of the vertebrate MT inferred by the Maximum Likelihood (ML) method using the Dayhoff + I + G substitution model implemented in the software SeaView v. 4.0. At the nodes are given values of ML non-parametric bootstrap. For full species name, refer to Table 1.

To better characterize the MTs from the different groups of vertebrates, we calculated the hydropathy indexes of MT proteins used for the phylogenetic analysis; the average values of hydropathy for each group are reported in Table 2. No significant differences in hydropathy values were found between MT1 and MT2 isoforms in fish, birds and mammals; in the latter, however, strong differences were observed among the different MT genes: the average hydropathy was +0.154 for MT1/MT2 isoforms, −0.383 for MT3 and +0.034 for MT4.

Table 2

Average hydropathy index for the metallothioneins of the different classes of vertebrates.

Average hydrophaty index
Mammals
 MT1–MT2 +0.154
 MT3 −0.383
 MT4 +0.034
Amphibians
 MT −0.286
Reptiles
 MT −0.169
Birds
 MT1–MT2 −0.187
Osteichthyes
 MT1–MT2 −0.117

4 Discussion

Compared with the complexity of MT evolution in invertebrates, the history and fate of MT family members in vertebrates seems to be more straightforward. The huge amount of knowledge gathered regards mammalian MTs, followed by piscine, avian and, more recently, reptilian MTs. The data presented in this paper represent the first comparative analysis on the primary structure of urodelian and anuran MTs. Data also show the phylogenetic relationship between the MT of amphibians and the other vertebrates.

Our results demonstrate an unexpected diversity both in terms of coding and 3′ untranslated regions. MT transcripts from the two species belonging to the genus Xenopus and the axolotl show 3′-UTRs of more than 500 nucleotides. In the axolotl, during embryogenesis three MT transcripts differing only in the length of their 3′-UTRs were described [23]. These transcripts did not arise from three different MT genes, but resulted from events of deadenylation and/or differential polyadenylation signals. In adults, a tissue-specific distribution of two of these transcripts was observed [23]. MT transcripts from the frog R. esculenta and the newt T. carniflex have shorter 3′-UTRs, of about 150 bp. The variability highlighted in the 3′-UTRs could imply differences in stability and translation of amphibian MT transcripts. Indeed, it has been demonstrated that the 3′-UTR offers a diversity of regulatory mechanisms. The untranslated regions control the subcellular localization of transcripts, as well as their translation and stability [30].

Our data record many significant differences also in the primary structure of amphibians MT. A part for the mammalian MT3 and MT4 isoforms, in vertebrates the number of amino acid residues for the MT1 and MT2 isoforms is typical and changeless within the class considered. In amphibians instead the length of the amino acid MT sequence is highly variable, with the three anuran MT displaying 62 amino acids, whereas T. carniflex and A. mexicanum MTs are of 63 and 60 residues, respectively. In particular, A. mexicanum MT lacks three amino acid residues before the first conserved cysteine at N-terminus. Noteworthy, the N-terminal residues upstream of the first cysteine are considered characteristic of the metallothionein origin [31] and the N-terminal region presents the major antigenic epitope [31,32]. Amphibian MTs show also a number of amino acid replacements. The two Xenopodinae X. laevis and X. tropicalis have a histidine residue between the 16th and 17th cysteine. The presence of the histidine residue in the MT sequence is typical of diapsids; it has been proposed that the histidine(s) in the MT sequence plays an important role in metal coordination and stabilization [33].

As for reptilians [19], in the amphibians in so far investigated no MT isoforms have been found. Actually, the paucity of data does not allow us to establish if this condition is typical of the entire class. In addition, the phylogenetic position of the 5 investigated taxa in the gene tree is sill unclear: the phylogenetic tree inferred using as dataset only the amphibian MTs is in contrast with the species tree; however, the presence of the other vertebrate MTs seems to influence the amphibian MT phylogeny. At the moment, we cannot rule out for amphibians a condition similar to that of reptiles, with paralogous genes lost or not sequenced [19,20].

Phylogenetic data presented in this study demonstrate that MT gene duplication in vertebrate species was generally an ancestral event occurred before their speciation; indeed the MT genes are segregated according to isoform and not to species in phylogenetic relationships. The only exceptions are in the piscine clade, where the duplication event seems to follow the speciation in Cypriniformes.

The phylogenetic analyses also indicate that mammalian MT4 is an ancestral form of MT. These results are in agreement with previous observations according to which the MT duplication in mammals occurred before their radiation [10,11]. In their studies about the phylogeny of the MT family in mammals, Moleirinho and coworkers [11] identified the MT4 as the most ancient MT form and hypothesized that it was lost in other tetrapods. Our analysis demonstrates that the avian MT1 is more ancient of the avian MT2 and clusters as a sister group of the mammalian MT4. Avian MT2, together with the paralogous reptilian MTs, forms a unique clade linked to the mammalian MT3 cluster.

The hydropathy index is a parameter inversely proportional to protein flexibility. A higher flexibility can facilitate the conformational changes necessary to the protein for maintaining functionality at low organismal body temperatures. Our previous observations demonstrated that MT hydropathy is a character displaying significant phylogenetic dependence and not associated to the thermal regime or to the environmental adaptation of animal species [15,19,34]. The levels of hydropathy measured for the MTs of the different groups of vertebrate used for this study give more validity to phylogenetic data: the hydropathy index of mammalian MT3 is similar to that of the other tetrapods, as well as the value for MT4 is quite different to that of MT1/MT2 isoforms. The low hydropatic value determined for the MT3 is also in agreement with the high degree of flexibility shown by this protein with respect to the other mammalian MT isoforms [35,36].

Disclosure of interest

The authors declare that they have no conflicts of interest concerning this article.

Acknowledgements

The authors wish to thank Prof. Anna Capaldo for providing the liver samples of the newt Triturus carniflex.


Bibliographie

[1] R.D. Palmiter The elusive function of met allothioneins, Proc. Natl Acad. Sci. U S A, Volume 95 (1998), pp. 8428-8430

[2] P. Coyle; J.C. Philcox; L.C. Carey; A.M. Rofe Metallothionein: the multipurpose protein, Cell Mol. Life Sci., Volume 59 (2002), pp. 627-647

[3] M. Nordberg; G.F. Nordberg Metallothioneins: historical development and overview (A. Sigel; H. Sigel; R.K.O. Sigel, eds.), Metal ions in life sciences: metallothioneins and related chelators, vol. 5, Royal Society of Chemistry, Cambridge, 2009, pp. 1-29

[4] P.A. Binz; J.H.R. Kagi Metallothionein: molecular evolution and classification (C. Klaassen, ed.), Metallothionein IV, Birkhauser Verlag, Basel, 1999, pp. 7-13

[5] C.A. Blindauer; O.I. Leszczyszyn Metallothioneins: unparalleled diversity in structures and functions for metal ion homeostasis and more, Nat. Prod. Rep., Volume 27 (2010), pp. 720-741

[6] M. Capdevila; S. Atrian Metallothionein protein evolution: a miniassay, J. Biol. Inorg. Chem., Volume 16 (2011), pp. 977-989

[7] Y. Uchida; K. Takio; K. Titani; Y. Ihara; M. Tomonaga The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein, Neuron, Volume 7 (1991), pp. 337-347

[8] R.S. Chung; A.K. West A role for extracellular metallothioneins in CNS injury and repair, Neuroscience, Volume 123 (2004), pp. 595-599

[9] C.J. Quaife; S.D. Findley; J.C. Erickson; G.J. Froelick; E.J. Kelly; B.P. Zambrowicz; R.D. Palmiter Induction of a new metallothionein isoform (MT-IV) occurs during differentiation of stratified squamous epithelia, Biochemistry, Volume 33 (1994), pp. 7250-7259

[10] L. Villarreal; L. Tıo; M. Capdevila; S. Atrian Comparative metal binding and genomic analysis of the avian (chicken) and mammalian metallothionein, FEBS J., Volume 273 (2006), pp. 523-535

[11] A. Moleirinho, J. Carneiro, R. Matthiesen, R.M. Silva, A. Amorim, L. Azevedo, Gains, losses and changes of function after gene duplication: study of the metallothionein family, PLoS One 6 (2011) e18487.

[12] C. Hogstrand; C. Haux Binding and detoxification of heavy metals in lower vertebrates with reference to metallothionein, Comp. Biochem. Physiol. C, Volume 100 (1991), pp. 137-141

[13] G.K. Andrews; L.P. Fernando; K.L. Moore; T.P. Dalton; R.J. Sobieski Avian metallothioneins: structure, regulation and evolution, J. Nutr., Volume 126 (1996) (1317S–1323S)

[14] L. Bargelloni; R. Scudiero; E. Parisi; V. Carginale; C. Capasso; T. Patarnello Metallothioneins in antarctic fish: evidence for independent duplication and gene conversion, Mol. Biol. Evol., Volume 16 (1999), pp. 885-897

[15] C. Capasso; V. Carginale; R. Scudiero; O. Crescenzi; R. Spadaccini; P.A. Temussi; E. Parisi Phylogenetic divergence of fish and mammalian metallothionein: relationships with structural diversification and organismal temperature, J. Mol. Evol., Volume 57 (2003), p. S250-S257

[16] D. Knapen; E.S. Redeker; I. Inàcio; W. De Coen; E. Verheyen; R. Blust New metallothionein mRNAs in Gobio gobio reveal at least three gene duplication events in cyprinid metallothionein evolution, Comp. Biochem. Physiol. C Toxicol. Pharmacol., Volume 140 (2005), pp. 347-355

[17] D.H. Nam; E.Y. Kim; H. Iwata; S. Tanabe Molecular characterization of two metallothionein isoforms in avian species: evolutionary history, tissue distribution profile, and expression associated with metal accumulation, Comp. Biochem. Physiol. C Toxicol. Pharmacol., Volume 145 (2007), pp. 295-305

[18] D.H. Nam; E.Y. Kim; H. Iwata Functional analysis of avian metallothionein isoforms: an ecotoxicological approach for assessing potential tolerability to element exposure, Environ. Sci. Technol., Volume 42 (2008), pp. 9391-9396

[19] F. Trinchella; M. Riggio; S. Filosa; E. Parisi; R. Scudiero Molecular cloning and sequencing of metallothionein in squamates: new insights into the evolution of the metallothionein genes in vertebrates, Gene, Volume 423 (2008), pp. 48-56

[20] R. Scudiero; S. Filosa; F. Trinchella Metallothionein gene evolution in vertebrates: events of gene duplication and loss during squamates diversification (L.V. Berhardt, ed.), Advances in medicine and biology, vol. 24, Nova Science Publisher, Hauppauge NY, 2011, pp. 321-335

[21] E. Saint-Jacques; C. Séguin Cloning and nucleotide sequence of a complementary DNA encoding Xenopus laevis metallothionein: mRNA accumulation in response to heavy metals, DNA Cell Biol., Volume 12 (1993), pp. 329-340

[22] J.P. Muller; D. Wouters-Tyrou; N.E. Erraiss; M. Vedel; N. Touzet; J. Mesnard; P. Sautière; M. Wegnez Molecular cloning and expression of a metallothionein mRNA in Xenopus laevis, DNA Cell Biol., Volume 12 (1993), pp. 341-349

[23] E. Saint-Jacques; J. Guay; L. Wirtanen; V. Huard; G. Stewart; C. Seguin Cloning of a complementary DNA encoding an Ambystoma mexicanum metallothionein, AmMT, and expression of the gene during early development, DNA Cell Biol., Volume 17 (1998), pp. 83-91

[24] M. Riggio; J. Lee; R. Scudiero; E. Parisi; D.J. Thiele; S. Filosa High affinity copper transport protein in the lizard Podarcis sicula. Molecular cloning, functional characterization and expression in somatic tissues, follicular oocytes and eggs, Biochim. Biophys. Acta, Volume 1576 (2002), pp. 127-135

[25] R.C. Edgar MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Res., Volume 32 (2004), pp. 1792-1797

[26] M. Gouy; S. Guindon; O. Gascuel SeaView version 4: a multiplatform graphical user interface for sequence alignment and phylogenetic tree building, Mol. Biol. Evol., Volume 27 (2010), pp. 221-224

[27] F. Abascal; R. Zardoya; D. Posada ProtTest: selection of best-fit models of protein evolution, Bioinformatics, Volume 21 (2005), pp. 2104-2105

[28] D. Posada; K.A. Crandall MODELTEST: testing the model of DNA substitution, Bioinformatics, Volume 14 (1998), pp. 817-818

[29] R.A. Pyron; J.J. Wiens A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians, Mol. Phylogenet. Evol., Volume 61 (2011), pp. 543-583

[30] B. Mazumder; V. Seshadri; P.L. Fox Translational control by the 3′-UTR: the ends specify the means, Trends Biochem. Sci., Volume 28 (2003), pp. 91-98

[31] P. Kille; W.E. Lees; B.M. Darke; D.R. Winge; C.T. Dameron; P.E. Stephens; J. Kay Sequestration of cadmium and copper by recombinant rainbow trout and human metallothioneins and by chimeric (mermaid and fishman) proteins with interchanged domains, J. Biol. Chem., Volume 267 (1992), pp. 8042-8049

[32] P. Kille; A. Hemmings; E.A. Lunney Memories of metallothionein, Biochim. Biophys. Acta, Volume 1205 (1994), pp. 151-161

[33] C.A. Blindauer Metallothioneins with unusual residues: histidines as modulators of zinc affinity and reactivity, J. Inorg. Biochem., Volume 102 (2008), pp. 507-521

[34] R. Scudiero; P.A. Temussi; E. Parisi Fish and mammalian metallothioneins: a comparative study, Gene, Volume 345 (2005), pp. 21-26

[35] Z.C. Ding; F.Y. Ni; Z.X. Huang Neuronal growth-inhibitory factor (metallothionein-3): structure–function relationships, FEBS J., Volume 277 (2010), pp. 2912-2920

[36] M. Vasak; G. Meloni Chemistry and biology of mammalian metallothioneins, J. Biol. Inorg. Chem., Volume 16 (2011), pp. 1067-1078


Cité par

  • Guangcui Xu; Weibing Li; Yingzheng Zhao; Ting Fan; Qiyu Gao; Yongbin Wang; Fengquan Zhang; Mingjing Gao; Zhen An; Zijiang Yang Overexpression of Lias Gene Alleviates Cadmium-Induced Kidney Injury in Mice Involving Multiple Effects: Metabolism, Oxidative Stress, and Inflammation, Biological Trace Element Research, Volume 202 (2024) no. 6, p. 2797 | DOI:10.1007/s12011-023-03883-x
  • Artur Krężel; Wolfgang Maret The Bioinorganic Chemistry of Mammalian Metallothioneins, Chemical Reviews, Volume 121 (2021) no. 23, p. 14594 | DOI:10.1021/acs.chemrev.1c00371
  • Shi-Long Ruan; Lei Xie; Jun-Wei Ou; Xue-Song Sun; Yong-Pu Zhang; Jian-Rao Hu Molecular cloning, the characterization of metallothionein and catalase, and the evaluation of testicular toxicity of Cd in the Chinese fire-bellied newt (Cynops orientalis), Ecotoxicology and Environmental Safety, Volume 208 (2021), p. 111731 | DOI:10.1016/j.ecoenv.2020.111731
  • Rosaria Scudiero; Mariailaria Verderame; Chiara Motta; Palma Simoniello Unravelling the Role of Metallothionein on Development, Reproduction and Detoxification in the Wall Lizard Podarcis sicula, International Journal of Molecular Sciences, Volume 18 (2017) no. 7, p. 1569 | DOI:10.3390/ijms18071569
  • Anna Capaldo; Flaminia Gay; Rosaria Scudiero; Francesca Trinchella; Ivana Caputo; Marilena Lepretti; Anna Marabotti; Carla Esposito; Vincenza Laforgia Histological changes, apoptosis and metallothionein levels in Triturus carnifex (Amphibia, Urodela) exposed to environmental cadmium concentrations, Aquatic Toxicology, Volume 173 (2016), p. 63 | DOI:10.1016/j.aquatox.2016.01.009
  • Halina Falfushynska; Lesya Gnatyshyna; Olga Fedoruk; Natalia Mitina; Alexander Zaichenko; Oksana Stoliar; Rostyslav Stoika Hepatic metallothioneins in molecular responses to cobalt, zinc, and their nanoscale polymeric composites in frog Rana ridibunda, Comparative Biochemistry and Physiology Part C: Toxicology Pharmacology, Volume 172-173 (2015), p. 45 | DOI:10.1016/j.cbpc.2015.04.006
  • Francesca Simoncelli; Silvia Belia; Ines Di Rosa; Romina Paracucchi; Roberta Rossi; Gianandrea La Porta; Livia Lucentini; Anna Fagotti Short-term cadmium exposure induces stress responses in frog (Pelophylax bergeri) skin organ culture, Ecotoxicology and Environmental Safety, Volume 122 (2015), p. 221 | DOI:10.1016/j.ecoenv.2015.08.001
  • Seong Lin Teoh; Satoshi Ogawa; Ishwar S. Parhar Localization of genes encoding metallothionein-like protein ( mt2 and smtb ) in the brain of zebrafish, Journal of Chemical Neuroanatomy, Volume 70 (2015), p. 20 | DOI:10.1016/j.jchemneu.2015.10.004
  • Gloria Isani; Emilio Carpenè Metallothioneins, Unconventional Proteins from Unconventional Animals: A Long Journey from Nematodes to Mammals, Biomolecules, Volume 4 (2014) no. 2, p. 435 | DOI:10.3390/biom4020435
  • Nina Serén; Scott Glaberman; Miguel A. Carretero; Ylenia Chiari Molecular Evolution and Functional Divergence of the Metallothionein Gene Family in Vertebrates, Journal of Molecular Evolution, Volume 78 (2014) no. 3-4, p. 217 | DOI:10.1007/s00239-014-9612-5
  • Li Yuhong; Harrison I. Atagana; Liu Jingchun; Wu Wenlin; Wu Shijun cDNA sequence encoding metallothionein protein from Aegiceras corniculatum and its gene expression induced by Pb2+ and Cd2+ stresses, Environmental Monitoring and Assessment, Volume 185 (2013) no. 12, p. 10201 | DOI:10.1007/s10661-013-3324-y

Cité par 11 documents. Sources : Crossref


Commentaires - Politique