Outline
Comptes Rendus

Molecular biology and genetics/Biologie et génétique moléculaires
Evaluating stripe rust resistance in Indian wheat genotypes and breeding lines using molecular markers
Comptes Rendus. Biologies, Volume 342 (2019) no. 5-6, pp. 154-174

Abstract

Stripe rust (yellow rust), caused by Puccinia striiformis f. sp. tritici (Pst), is a serious disease of wheat worldwide, including India. Growing resistant cultivars is the most cost-effective and eco-friendly approach to manage the disease. In this study, 70 publically available molecular markers were used to identify the distribution of 35 Yr genes in 68 wheat genotypes. Out of 35 Yr genes, 25 genes amplified the loci associated with Yr genes. Of the 35, 18 were all-stage resistance ASR (All-stage resistance) genes and 7 (Yr16, Yr18, Yr29, Yr30, Yr36, Yr46 & Yr59) were APR (Adult-plant resistance) genes. In the field tests, evaluation for stripe rust was carried out under artificial inoculation of Pst. Fifty-three wheat genotypes were found resistant to yellow rust (ITs 0), accounting for 77.94% of total entries. Coefficients of infection ranged from 0 to 60 among all wheat genotypes. Two genotypes (VL 1099 & VL 3002) were identified with maximum 15 Yr genes followed by 14 genes in VL 3010 and HI8759, respectively. Maximum number of all-stage resistance genes were identified in RKD 292 (11) followed by ten genes in DBW 216, WH 1184 and VL 3002. Maximum number of adult-plant resistance gene was identified in VL 3009 (6), HI 8759 (5) and Lassik (4) respectively. Genes Yr26 (69.2%), Yr2 (69.1%), Yr64 (61.7%), Yr24 (58.9%), Yr7 (52.9%), Yr10 (50%) and Yr 48 (48.5%) showed high frequency among selected wheat genotypes, while Yr9 (2.94%), Yr36 (2.94%), Yr60 (1.47%) and Yr32 (8.8%) were least frequent in wheat genotypes. In future breeding programs, race specific genes and non-race specific genes should be utilised to pyramid with other effective genes to develop improved wheat cultivars with high-level and durable resistance to stripe rust. Proper deployment of Yr genes and utilizing the positive interactions will be helpful for resistance breeding in wheat.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2019.04.002
Keywords: Wheat, Molecular detection, Puccinia striiformis f. sp. tritici, Yellow rust, Yr gene

Reema Rani  1 , 2 ; Rajender Singh  3 ; Neelam R. Yadav  1

1 Department of Molecular Biology, Biotechnology & Bioinformatics, Chaudhary Charan Singh Haryana Agricultural University, 125004 Hisar, Haryana, India
2 ICAR-Directorate of Rapeseed-Mustard Research Centre, Sewar, 321303 Bharatpur, Rajasthan, India
3 Department of Plant Pathology, Chaudhary Charan Singh Haryana Agricultural University, 125004 Hisar, Haryana, India
@article{CRBIOL_2019__342_5-6_154_0,
     author = {Reema Rani and Rajender Singh and Neelam R. Yadav},
     title = {Evaluating stripe rust resistance in {Indian} wheat genotypes and breeding lines using molecular markers},
     journal = {Comptes Rendus. Biologies},
     pages = {154--174},
     year = {2019},
     publisher = {Elsevier},
     volume = {342},
     number = {5-6},
     doi = {10.1016/j.crvi.2019.04.002},
     language = {en},
}
TY  - JOUR
AU  - Reema Rani
AU  - Rajender Singh
AU  - Neelam R. Yadav
TI  - Evaluating stripe rust resistance in Indian wheat genotypes and breeding lines using molecular markers
JO  - Comptes Rendus. Biologies
PY  - 2019
SP  - 154
EP  - 174
VL  - 342
IS  - 5-6
PB  - Elsevier
DO  - 10.1016/j.crvi.2019.04.002
LA  - en
ID  - CRBIOL_2019__342_5-6_154_0
ER  - 
%0 Journal Article
%A Reema Rani
%A Rajender Singh
%A Neelam R. Yadav
%T Evaluating stripe rust resistance in Indian wheat genotypes and breeding lines using molecular markers
%J Comptes Rendus. Biologies
%D 2019
%P 154-174
%V 342
%N 5-6
%I Elsevier
%R 10.1016/j.crvi.2019.04.002
%G en
%F CRBIOL_2019__342_5-6_154_0
Reema Rani; Rajender Singh; Neelam R. Yadav. Evaluating stripe rust resistance in Indian wheat genotypes and breeding lines using molecular markers. Comptes Rendus. Biologies, Volume 342 (2019) no. 5-6, pp. 154-174. doi: 10.1016/j.crvi.2019.04.002

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

Stripe (yellow) rust caused by Puccinia striiformis f. sp. tritici (Pst) is the most destructive fungal disease for wheat, especially in cool temperate and humid environment of wheat producing regions like India, China, US, Australia and the middle east [1,2]. Wheat is a widely cultivated cereal crop and acts as staple food to 35% of the world's population, providing 8 to 15% proteins, up to 20% of calories intake and nearly 55% of the carbohydrate [3]. In India, yellow rust (YR) severely affects wheat production in North-Western plain zone as well as Northern hills zone due to the favourable environment for rust pathogens [4,5]. The rust fungus can travel by wind through urediniospores over thousands of kilometres from the initial infection sites [6] and exerts greatest damage by preventing transport of water and nutrients through the host. It causes decrease in seed vigour leading to shrivelled grains, loss in number of grains per spike and of grain weight. Disease loss can range up to 10–70% to complete crop failure [7]. The predominant pathotypes i.e. 46S119 and 78S84 are adversely affecting wheat production in the northern wheat growing region of India [8,9]. A Yellow rust pathotypes profiling in Punjab showed the dominance of race 46S119 in 84% of collected yellow rust samples [10]. Since 2011, the frequency of 46S119 has increased up to 74% whereas that of 78S84 has reduced to 18.5%, due to the favourable cold and humid climate over the years [11]. This shift in virulence and rapid emergence of new races has resulted in breakdown of major resistance genes Yr2, Yr9 and Yr27, rendering widely-planted wheat varieties (PBW 343 and HD 2967) susceptible [11]. YR genes such as Yr5, Yr10, Yr11, Yr12, Yr13, Yr14, Yr15, Yr24, Yr26, YrSp, and Yrsk are still effective and could be used in breeding programs, while Yr2, Yr3, Yr4, Yr6, Yr7, Yr8, Yr9, Yr17, Yr18, Yr19, Yr21, Yr22, Yr23, Yr25, Yr27 and YrA have become ineffective to the currently prevalent or new races [12]. Presently, 76 Yr genes have been catalogued in wheat [13] in which mostly confer race-specific all-stage resistance, and some confer adult-plant or high temperature adult-plant (HTAP) resistance [7,14]. Breeding for resistant cultivars is considered the most effective, economic and environmentally friendly approach to control stripe rust [15,16]. Race-specific resistance with single resistance gene is often short lived. Gene pyramiding strategies deploying race-specific and non-race specific resistance genes is required to achieve durable resistance [17]. However, detailed knowledge of resistance genes present in wheat cultivars is a prerequisite in resistance breeding. Therefore, evaluation and distribution of Yr genes needs to be done in breeding wheat genotypes to identify and select resistant cultivar. Molecular marker assisted detection is the most convenient and reliable method to identify the presence of Yr genes [18,19]. A wide range of markers are reported to be associated with Yr genes in wheat including STS (Yr5- [20]), SSR (Yr10- [21]; Yr15, Yr26, YrH52- [22]), EST (Yr26- [23]), STS/CAPS ([24]; YrMoro- [25]), STS (Yr61- [26]), DArt (Yr51- [27]), RGAP/SSR (Yr59- [28]) and SSR (Yr 50- [29]; Yr64 and Yr65- [30]). Canadian YR resistant wheat varieties were identified with Yr 10, Yr17, Yr18 and Yr 36 linked markers [31]. Ullah et al. [32] screened 99 wheat genotypes using markers linked with Yr5, Yr10, Yr17 and Yr9. Iqbal et al. [33] studied the allelic variation for markers Xgwm 11, CYS5, Xpsp3000, S19M93-140, cSLv34, VENTRIUP/LN2 and Barc181 linked with Yr5, Yr9, Yr10, Yr17, Yr26 in 67 Pakistani wheat varieties. Kumar et al. [34] evaluated 19,460 Indian wheat accessions to identify new sources of resistance to rust using molecular markers. Similar studies were performed using 330 cultivars and 164 breeding genotypes from China [35]. Zheng et al. [36] studied the distribution of 36 Yr genes in 672 wheat accessions in USA and observed significant additive effects in some gene combinations, such as Yr9 + Yr18 and Yr30 + Yr46.

The present study was conducted to explore the rust resistance potential of advanced wheat genotypes and varieties using molecular markers linked with YR resistance genes. The information generated on gene sources of rust resistance will prove vital for developing pre-breeding potential genotypes and high yielding rust resistant varieties. The gene specific rust resistant wheat varieties so developed and deployed would not only reduce cost of cultivation spent on fungicides but would also save environment from pollution.

2 Materials and methods

2.1 Plant materials

A total of 68 wheat genotypes (Table 1) were used for molecular and field evaluation at the Chaudhary Charan Singh Haryana Agricultural University (CCS HAU), Hisar, India.

Table 1

List of the genotypes used for molecular and field evaluation.

Table 1
Sr. No. Genotype Sr. No. Genotype Sr. No. Genotype
1 HI 8759 (d) 25 WB 2 49 WH 1184
2 PBW 723 26 AKAW 4842 50 HS 580
3 HI 8774 (d) 27 DBW 179 51 VL 1009
4 HPPAU 05 28 DBW 216 52 UP 2954
5 HPW 423 29 DBW 217 53 UP 2955
6 HPW 433 30 DBW 219 54 VL 3002
7 HS 622 31 DDK 1050 (dic.) 55 VL 3010
8 HS 623 32 DDK 1051 (dic.) 56 VL 3011
9 HS 626 33 GW 477 57 VL 3012
10 HS 628 34 MACS 5044 (dic.) 58 WH 1181
11 PBW 725 35 MACS 5046 (dic.) 59 WH 1216
12 PBW 756 36 NW 6094 60 WH 1310
13 PBW 757 37 PBW 621 61 HD 3171
14 PBW 760 38 RKD 292 (d) 62 Lassik
15 RKD 283 (d) 39 VL 4001 63 WH 711
16 TL 3006 (T) 40 WH 1215 64 PBW 343
17 TL 3007 (T) 41 DBW 220 65 WH 542
18 TL 3008 (T) 42 HPBW 02 66 WH 1105
19 TL 3009 (T) 43 HPPAU 08 67 HD 2967
20 UAS 459 (d) 44 HPPAU 10 68 Kharchia
23 HI 1605 47 NW 6046
24 K 1317 48 PDW 344 (d)

2.2 Molecular markers

Two or three closely linked markers of each YR gene were chosen to identify its presence or absence in the wheat genotypes, except a few genes for which only one closely linked marker was reported. A total of 70 markers (SSR, CAPS, RGAP, STS, EST-SSR) were used for profiling the wheat genotypes. Sequences of available markers (Table 2) along with their previously determined chromosomal locations were obtained from Graingenes database (http://wheat.pw.usda.gov/). Primers were synthesized from Eurofins Genomics India Pvt. Ltd, Bangalore and Imperial life sciences Pvt. Ltd. India.

Table 2

Primers’ name, sequences, distance, location, product size, annealing temperature, and references for stripe rust resistance genes.

Table 2
Gene Linkage Chromosome position Source genotypes Type of resistance conferred Marker name Type of Marker Primer sequence Annealing Temperature Distance (cm) Product size References
Yr2 7B RS Wmc364 SSR ATCACAATGCTGGCCCTAAAAC
CAGTGCCAAAATGTCGAAAGTC
56 5.6 200 (+), 190 (–) Feng et al. [113]
Yr5 Yr7 (allelic or linked) 2B Triticum aestivum subsp. spelta ‘Album’ RS, AS Wmc175
SSR GATAAAATCATTATTGGGTGTCCTTT
TTCAAATAATCTTTCATCAGTCAAATG
55 1.1 Not amplified Sun et al. [46]
Xgwm501 SSR ACTTACATGAATTATCTTTCTTGGTCC
CGTATTCAAATAATCTTTCATCAGTCA
55 10.5–13.3 100, 150, 176 (+) Sun et al. [46]
STS7/8 STS GTACAATTCACCTAGAGT
GCAAGTTTTCTCCCTATT
45 0.3 500 (+) Murphy et al. [48]
S19M93 STS TAATTGGGACCGAGAGACG
TTCTTGCAGCTCCAAAACCT
58 0 100 (+) Smith et al. [47]
Barc349 SSR CGAATAGCCGCTGCACAAG
TATGCATGCCTTTCTTTACAAT
58 0.4 100, 105 (+), 120, 140, 220 Murphy et al. [48]
Barc167 SSR AAAGGCCCATCAACATGCAAGTACC
CGCAGTATTCTTAGTCCCTCAT
55 2.6 Not amplified Smith et al. [47]
Yr7 Sr9g 2BL T. turgidum (lumillo durum) RS, AS Xgwm526 SSR CAATAGTTCTGTGAGAGCTGCG CCAACCCAAATACACATTCTCA 55 5.6 75, 78, 95, 140, 145 (+) Yao et al. [51]
CFD77 SSR CTGCTTCAGGGATTGGAGAG
GTTTCCTGGGCTAAACCACA
58 220 USDA
Yr9 Sr31/Lr26/Sr50 1RS/1BL Secalis cereal (Imperial rye) RS, AS Xgwm582 SSR AAGCACTACGAAAATATGAC
TCTTAAGGGGTGTTATCATA
45 3.7 150 (+), null Cabuk et al. [54]
STS (Sr31) STS CTCTGTGGATAGTTACTTGATCGA
CCTAGAACATGCATGGCTGTTACA
58 0 Not amplified USDA
IB-267 SSR GCAAGTAAGCAGCTTGATTTAGC AATGGATGTCCCGGTGAGTGG 56 0 267 (+), null Mago et al. [55]
Xwgp8 RGAP CTCTGTATACGAGTTGTC
GAGGAAGGACAGGTTGCC
60 Not amplified USDA
Yr10 1BS ‘Moro’ RS, AS Xpsp3000

SSR
GCAGACCTGTGTCATTGGTC
GATATAGTGGCAGCAGGATACG
52
1.5
240 (–),
220 (+), 260 (+), 285 (+)
Bariana et al. [60]
Yr15 YrCH52
(close)
1BS T. turgidum var. dicoccoides G-25 RS, AS Xgwm413 SSR TTTTTGGCTTATTAGACTGACTT
TTGCCATAAAATACAAAATCC
50 4.3 90, 95 (+), 100 (–) Murphy et al. [48]
Xgwm11 SSR AAAAGGAACCTCAAGTGACA
GAAAATGAGGGAGTGAGATG
52 Not amplified Cheng et al. [30]
Xgwm273
SSR ATTGGACGGACAGATGCTTT
AGCAGTGAGGAAGGGGAT C
58 0.4 156 (+), 165
170, 180, 190, 200
Revathi et al. (2010) [114]
Xbarc8 SSR GCGGGAATCATGCATAGGAAAACAGAA
GCGGGGGCGAAACATACACATAAAAACA
56 4.2 260 (+), 280 Murphy et al. [48]
Xgwm18
SSR TGGCGCCATGATTGCATTATCTC GGTTGCTGAAGAACCTTATTTAGG 52 Not amplified Cabuk et al. [54]
Xgwm33 SSR GGAGTCACACTTGTTTGTGCA
CACTGCACACCTAACTACCTGC
55 4.5 Not amplified Somers et al. [128]
Yr16 2AS, 2DS Capelle-Desprez NRS, AP Xgwm102
(QTL)

SSR
TCTCCCATCCAACGCCTC TGTTGGTGGCTTGACTATTG 57 150 (–), 155 (+), 200 (+) Agenbag et al. [63]
Xgwm 249 SSR CAAATGGATCGAGAAAGGGA
CTGCCATTTTTCTGGATCTACC
58 120–160 Agenbag et al. [63]
Yr17 Lr37/Sr38 2AS T. ventricosa RS, AS
VENTRIUP-LN2
AGGGGCTACTGACCAAGGCT
TGCAGCTACAGCAGTATGTACACAAAA
58 T. ventricosum
chromosome specific

259 (+), null

Halguera et al. (2003) [24]
URIC/LN2 CAPS GGTCGCCCTGGCTTGCACCT
TGCAGCTACAGCAGTATGTACACA AAA
58 285 (+), 166 (–), 109 (–) Halguera et al. (2003) [24]
Yr18 Lr34 7D Frontana NRS, AP csLV34 GTTGGTTAAGACTGGTGATGG
TGCTTGCTATTGCTGAATAGT
58 0.4 150 (+), 229 (–) Lagudah et al. [65]
Cssfr1 Gene based TTGATGAAACCAGTTTTTTTTCTA
GCCATTTAACATAATCATGATGGA
56 0 Not amplified Lagudah et al. [129]
Cssfr2 Gene based TTGATGAAACCAGTTTTTTTTCTA
TATGCCATTTAACATAATCATGAA
55 0 517 (+), null Lagudah et al. [129]
Cssfr5 Gene based TTGATGAAACCAGTTTTTTTTCTA
TATGCCATTTAACATAATCATGAA
57 0 Not amplified Lagudah et al. [129]
Xgwm295 SSR GTGAAGCAGACCCACAACAC
GACGGCTGCGACGTAGAG
55 Variable bands Bariana et al. [117]
CHR5 RGAP GCATTGGAACAAGGTGAA
GGIGGIGTIGGIAAIACIAC
0 Not amplified Wen et al. [69]
Yr24 Yr24, YrCH42 1BS T. turgidum RS, AS Barc181 SSR CGCTGGAGGGGGTAAGTCATCAC
CGCAAATCAAGAACACGGGAGAAAGAA
58 6.7 180 (+), 220 (–) Wang et al. [68]; Zhang et al. [23]
Yr25 1D RS, AS Xgwm6 SSR CGTATCACCTCCTAGCTAAACTAG
AGCCTTATCATGACCCTACCTT
52 150 [131]
Yr26 Yr24, YrCH42 1BS Haynaldia villosa RS, AS Barc187 SSR GTGGTATTTCAGGTGGAGTTGTTTTA
CGGAGGAGCAGTAAGGAAGG
57 2.3 200 (+), 220 (–), 225 Wen et al. [69]
CON-6 (EST) ESTSSR GCCGATGGGGAACTGAAT
GTTGAACCGCTTGAACACC
52 0 Not amplified Zhang et al. [23]
CYS-5 RGAP GCATTGGAACAAGGTGAA
GGIGGIGTIGGIAAIACIAC
58 0 Not amplified Wen et al. [69]
Xgwm498 SSR GGTGGTATGGACTATGGACACT
TTTGCATGGAGGCACATACT
60 1.6 160 (+), null Li et al. [67]
Yr27 Lr13 2BS Selkirk RS, AS Xgwm630 SSR GTGCCTGTGCCATCGTC
CGAAAGTAACAGCGCAGTGA
55 10 124 (+) Seyfarth et al. (2000) [119]
Yr29 Lr46, YrChk 1BL Lalbahadur NRS, AP Xgwm259 SSR AGGGAAAAGACATCTTTTTTTTC
CGACCGACTTCGGGTTC
56 (Yrchk: 9.1) Not amplified Lilemo et al. (2008) [120]
Wmc44 SSR GGTCTTCTGGGCTTTGATCCTG
TGTTGCTAGGGACCCGTAGTGG
58 3.6
(Yrchk: 8.3)
205, 210, 220, 240, 260 (+), 280, 300, 320 Rosewarne et al. [75];
Liu et al. (2007) [121]
Yr30 Sr2, Lr27 3BS Opata 85 NRS, AP Xgwm533 SSR AAGGCGAATCAAACGGAATA
GTTGCTTTAGGGGAAAAGCC
57 100, 120 (+), 130, 140, 150 Spielmeyer et al. (2003) [122]
csSr2
CAPS CAAGGGTTGCTAGGATTGGAAAACA
AGATAACTCTTATGATCTTACATTTTTCTGA
56 0 Not amplified Mago et al. (2011) [123]
Yr32 2AL Carstens V RS, AS Wmc198 SSR CACGCTGCCATCACTTTTAC
TTGAAGTGGTCATTGTTGCT
58 2 180, 200 Eriksen et al. [80]
Yr35 Lr53 6BS T. dicoccoides RS, AS CFD1 SSR CCTCCATGTAGGCGGAAATA TGTGTCCCATTCACTAACCG 57 4.1 Not amplified Dadkhodaie et al. [132]
Yr36 Gpc-B1 6BS T. dicoccoides NRS, HTAP Barc101 SSR GCTCCTCTCACGATCACGCAAAG
GCGAGTCGATCACACTATGAGCCAATG
58 2 116, 124 (+), 138, 160, 165 Uauy et al. [82]
ASA (Gpc-B1) Gene based CTACCATCGAAAGTTGATAGGGA
TTCACAAACTAAGGGGAGGGA
57 0.3 1.6Kb (+), null Uauy et al. [82]
WKS1 Gene based ATCCATTGCCAAGTCAACCAC
TCACTTCCATGAAGGAGGTC
55 0 128 (+), null Fen et al. (2009) [83]
Fu et al. (2009) [[130]]
Yr39 7BL Alpowa NRS, HTAP Xwgp36:
Pto kin1/RLK For

RGAP
GCATTGGAACAAGGTGAA
GAYGTNAARCCIGARAA
55 0.8 Not amplified Lin and Chen [115]
Xwgp45:Pto kin1/XLRR For RGAP GCATTGGAACAAGGTGAA
CCGTTGGACAGGAAGGAG
52 6.6 Not amplified
Yr40 Lr57 5DS Aegilops geniculata RS, AS Xfbb276 SSR AACAGCTATGACCATG
GTAAAACGACGGCCAGT
48 1 kb, 2 kb, null Kuraparthy et al. [84]
Yr45 3DL RS, AS Xwgp115
RGAP AGTGTCTTGTAGGGTATC
TCAGGCCGTGAAAAATAT
46 4.8 Not amplified Li et al. (2011) [124]
Xwgp118 RGAP AAGTGGAACAAGGTTACG
ACACTGGTCCATGAGGTT
48 5.8 Not amplified Li et al. (2011) [124]
Yr46 Lr67/Sr55/Pm46 4DL Thatcher RS, AS CFD71 SSR CAATAAGTAGGCCGGGACAA
TGTGCCAGTTGAGTTTGCTC
52 148 (+), 150, 152 Hiebert et al. (2010) [125]
CFD23 SSR TAGCAGTAGCAGCAGCAGGA
GCAAGGAAGAGTGTTCAGCC
55 211 (+), 214 (+) Hiebert et al. (2010) [125]
Yr47 Lr52 5BS T. aestivum RS, AS Cfb309
SSR
(BAC Contig)
TAGGGCATATTTCCAACACT
TAAGTCCGCGTATTAGCATT
58 8–12 600 (+), 350 (–) Bansal et al. [86]
Yr51 4AL RS, AS Sun104 STS TGCTATGTGCGTGATGATGA
TTACATGCTCCAGCGACTTG
56 2.5 225 (+), null (–) Randhawa et al. [27]
owm45F3R3
SSR GGCTCGTCTACACCAACGAC
TTGGGGTCTTTAGGCATGAG
56 1.2 1 kb (non conclusive) Randhawa et al. [27]
Yr59 7BL Alpowa NRS, HTAP Barc32 SSR GCGTGAATCCGGAAACCCAATCTGTG
TGGAGAACCTTCGCATTGTGTCATTA
62 2.1 165 (+), 175, 190, 250 Zhou et al. [26]
Wmc557 SSR GGTGCTTGTTCATACGGGCT
AGGTCCTCGATCCGCTCA
56 < 2.1 315 (+), 500 Zhou et al. [26]
Yr60 4AL T. aestivum RS, AS Wmc776 SSR CCATGACGTGACAACGCA
ATTGCAGGCGCGTTGGTA
56 < 0.6 150, 160, 170 (+) Herrera-Foessel et al. [85]
Wmc313 SSR GCAGTCTAATTATCTGCTGGCG
GGGTCCTTGTCTACTCATGTCT
60.3 0.6 180, 200 (+) Herrera-Foessel et al. [85]
Wmc219 SSR TGCTAGTTTGTCATCCGGGCGA
CAATCCCGTTCTACAAGTTCCA
57 0.6 200 (+), 220 Herrera-Foessel et al. [85]
YrCH52 Yr15 1BS T. turgidum RS, AS Xgwm273 SSR ATTGGACGGACAGATGCTTT AGCAGTGAGGAAGGGGATC 48 2.7 170, 180, 190, 200 Cabuk et al, (2011) [54]
YrSpP 2B Spaldings Profilic RS, AS Wmc441 SSR TCCAGTAGAGCACCTTTCATT ATCACGAAGATAAACAAACGG 56 12.1 Not amplified Guan et al. (2005) [116]
Yr48 5AL Aegilops tauschii NRS, AP cfa2149 SSR CTT GGA GCT CGG GTA GTA GC
AAG GCA GCT CAA TCG GAG TA
52 0.06 225 (+), 250 Lowe et al. (2011) [126]
SNF-A2 SSR TCCGTCTCCATCATTCAACA
GTGTTGCGCAAGTTTGTGAC
58 0.18 150 (+),
180, 200 (–)
Lowe et al. (2011) [126]
BE495011 SSR TGATTACTGTAGCTACCTCCTCCT
GGTGCAAGATGTGCCTGTAA
56 0.09 220 (+), null Lowe et al. (2011) [126]
YrCN19 2BS AIM6 RS, AS Xgwm410 SSR GCTTGAGACCGGCACAGT
CGAGACCTTGAGGGTCTAGA
57 0.3 Not amplified Luo et al. (2008) [117]
YrZH84 7B RS, AS Barc32 SSR GCGTGAATCCGGAAACCCAATCTGTG
TGGAGAACCTTCGCATTGTGTCATTA
56 4.8 165 (+), 170, 190, 250
Zhou et al. ([26]; [125])
YrMor 4B Moro RS, AS S26M47 SSR TTTACAGGTTGGAATCTA
GAATATACCTTTTCTTCAA
55 0 250 (+), null Smith et al. [25]
YrHua RS, AS PM14 STS GTACATGCAGACAGAAAGAGAGAA
TGATGAGTCCTGAGTAACTC
58 5.4 Not amplified Cao et al. (2008) [127]
YrExp1 RS, AS Wmc631 SSR TTGCTCGCCCACCTTCTACC
GGAAACCATGCGCTTCACAC
60 3.4 Not amplified Lin and Chen (2008) [118]

2.3 DNA extraction, PCR amplification and electrophoresis

Genomic DNA was isolated from 100 mg fresh leaf tissue collected from each line using the CTAB extraction method of Murray and Thompson [37] as modified by Saghai-Maroof et al. [38] and Xu et al. [39]. The DNA stock solution was adjusted to a concentration of 100–150 ng/μl with nuclease free sterile water as the working concentration for the polymerase chain reaction (PCR) and stored at -20° C. PCR reactions were performed using a Benchtop thermocycler in 25 μl of a PCR mixture containing 100–150 ng of genomic DNA, 2 units of Taq DNA polymerase (Promega), 1X PCR buffer (10 mM Tris HCL), 2.5 mM of MgCl2, 100 μM of each dNTP, and 10 μM of each primer. The Touchdown PCR protocol was used to increase the specificity and sensitivity in PCR amplifications. The annealing temperature for Touchdown PCR was optimized using the melting temperature recommended by the primer synthesis user's guide. The initial program provided for a decrease of 0.5 °C for 40 s per 5 cycles from 65 to 60 °C; the second one started at 60 °C with a decrease of 0.5 °C for 40 seconds per 30 cycles. PCR products were separated on 1.5–2.5% agarose gels (depending on gene product size) or 6% denaturing polyacrylamide gel and visualized under UV light using the digital gel imaging system (MultiDoc-It). For the primer pair URIC/LN2, the PCR products were digested with Dpn II (New England Biolabs, USA) according to Chen et al. [20] before electrophoresis. The restriction digestion mixture contained 10 μl of PCR product, 1U of restriction enzyme Dpn II (New England Biolabs) and 2 μl of 10 X buffer for Dpn II (New England Biolabs). Samples were incubated at 37 °C for 4 h and the digested products were separated in a 6% polyacrylamide gel.

2.4 Field evaluation under artificial inoculation of Puccinia striiformis f. sp. tritici for stripe rust

All 68 wheat genotypes were evaluated under epiphytotic condition by artificial inoculation of mixture of pathotypes including 46S119, 110S119, 110S84 & 78S84 (106/ml) at seedling/tillering stage of Pst through spray for stripe rust reaction in the research field of CCS HAU, Hisar (latitude 29°10 ’N, longitude 75°46 ’E, altitude 215.2 m) in India during the 2016–17 cropping season. Sowing was done in mid November. Approximately, 10 g seeds of each of the 68 wheat genotypes were planted in 2 m furrow length with a distance of 25 cm between each furrow in the field. The infectors (mixture of susceptible cv. i.e. Kharchia, Agra Local, WH143, Lal Bahadur & Bajara Yellow) were sown after every 20 furrows and around the plots as natural spreaders of stripe rust inoculum. Infection types (ITs) of seedlings were recorded in late January and early February when the plants were at tillering/stem elongation stage and disease severity (DS) data was also recorded. In late March, terminal disease severity was also recorded using modified Cobb's scale [40]. The immune plant with no visible symptoms was scored as IT-0, the highly resistant plant with little necrotic flecks and no sporulation was scored as IT-1, the moderately resistant plant with a few necrotic flecks and trace sporulation was scored as IT-2, the moderately susceptible plant with necrotic blotches and moderate sporulation was scored as IT-3, the highly susceptible plant with chlorotic stripes and abundant sporulation was scored as IT-4. Disease severities were assessed based on the percentage of leaf area affected (0, 1, 5, 10, 20, 30, 40, 60, 80, and 100%) [41]. Disease severity were recorded as R (Resistant) when small necrotic areas and no uredia were present, MR (moderately resistant) when small uredia with slight sporulation, chlorosis or necrosis, MS (moderately susceptible) when medium-size uredia with moderate sporulation, and some chlorosis may still be present, and S (susceptible) when large uredia with abundant sporulation, and often coalesced to form lesions without evidence of stripes on visible chlorosis or necrosis [42].

3 Results and discussion

3.1 Adult-plant stage rust evaluation in field under artificial conditions

At the adult-plant stage, disease data on infection types and severity was recorded on 68 wheat genotypes as depicted in Tables 3 and 4. Fifty-three genotypes were found resistant (ITs 0), accounting for 77.94% of total genotypes, 3 genotypes (4.4%) (RKD 292, VL 3002, and DBW 179) showed trace resistance (ITs 1), 7 genotypes (10.3%) (HD 3209, AKAW 4842, DDK 1050, GW 477, MACS 5044, MACS 5046 and NW 6094) were moderately susceptible (ITs 3) and 5 genotypes (7.35%) (HD 3171, DDK 1051, Infector, WH 711 and PBW 343) were susceptible (ITs 4). According to disease severity, 53 lines exhibited immune response, 7 genotypes (10.3%) (HD 3209, AKAW 4842, DDK 1050, GW 477, MACS 5044, MACS 5046 and NW 6094) showed 10 percentage severity of moderately susceptible type (10MS), one genotype (1.5%) HD 3171 contracted 5 percentage severity of susceptible type (5S), 4 genotypes (5.9%) (DDK 1051, WH 711, PBW 343 and Infector) obtained 60 percentage severity of susceptible type (60S). Infector rows expressed 60 percentage severity of susceptible type (60S). Coefficient of infection ranged from 0 to 60 among all wheat genotypes in which 0 CI is associated with the immune and resistant genotypes and 60 CI is associated with susceptible genotypes. Overall 60 genotypes expressed yellow rust resistance under field conditions against predominant yellow rust pathotypes i.e. 46S119, 110S119, 110S84 &78S84.

Table 3

Field response, severity, and coefficient of infection of wheat genotypes.

Table 3
Genotypes Field Severity response & symbol No. of Lines Average Coefficient of Infection (ACI)
RKD 292, VL3002, DBW179 Ts (R) 3 0.2
HD 3209, AKAW 4842, DDK 1050, GW 477, MACS 5044, MACS 5046, NW 6094 10MS 7 8.0
HD 3171 5S 1 5.0
DDK1051, Infector, WH 711, PBW 343 60S 4 60.0
Remaining genotypes Immune 53 0
Table 4

Data on infection types (ITs) in the selected wheat genotypes.

Table 4
Wheat genotypes Infection response (field) Total No. of genotypes ITs
RKD 292, VL3002, DBW179 Ts 3 1
HD3209, AKAW4842, DDK 1050, GW477, MACS 5044, MACS 5046, NW6094 MS 7 3
HD3171, DDK1051, Infector, WH711, PBW343 S 5 4
All remaining genotypes R 53 0

3.2 Detecting stripe (yellow) rust resistance genes using molecular markers

Marker assisted detection of 35 Yr genes in wheat genotypes was carried out using 70 Yr gene linked markers. The results indicated the effectiveness of these markers for specific Yr gene which also identified the resistant lines containing multiple Yr genes. Details of Yr resistance genes in wheat genotypes are presented in Table 5. Molecular identification of various genes is discussed below.

Table 5

Details of Yr resistance genes in wheat genotypes.

Table 5
S. no. Genotypes RS, AS genes APR genes Total number of RS, AS genes Total number of APR genes Total number of genes Resistant Types
1 HI 8759 (d) Yr2, Yr7, Yr10, Yr15, Yr24, YrcH52, Yr47, YrZH84 Yr16, Yr18, Yr29, Yr30, Yr48, Yr59 8 6 14 R
2 PBW 723 Yr2, Yr9, Yr24, YrZH84 Yr16, Yr30, Yr59 4 3 7 R
3 HI 8774 (d) Yr2, Yr7, Yr10, Yr24, Yr40, Yr60 Yr18, Yr30, Yr48 6 3 9 R
4 HPPAU 05 Yr2, Yr7, Yr9, Yr10, Yr15, Yr24, Yr26, Yr64, YrMor Yr18, Yr30, Yr36 9 3 12 R
5 HPW 423 Yr2, Yr10, Yr24, Yr26, Yr64 Yr18, Yr30 5 2 7 R
6 HPW 433 Yr2, Yr7, Yr10, Yr26, Yr47, YrMor Yr18, Yr48 6 2 8 R
7 HS 622 Yr2, Yr7, Yr24, Yr26 Yr30 4 1 5 R
8 HS 623 Yr2, Yr7, Yr26, YrMor Yr18, Yr29, Yr30 4 3 7 R
9 HS 626 Yr5, Yr7, Yr10, Yr24, Yr26, Yr40, Yr47, Yr64 Yr16, Yr29, Yr30 8 3 11 R
10 HS 628 Yr2, Yr7, Yr15, YrcH52, Yr64 Yr30 5 1 6 R
11 PBW 725 Yr2, Yr15, Yr24, Yr26, Yr64 Yr29, Yr30 5 2 7 R
12 PBW 756 Yr2, Yr10, Yr64 Yr30 3 1 4 R
13 PBW 757 Yr2 Yr59 1 1 2 R
14 PBW 760 Yr2, Yr7, Yr24, YrMor Yr59 4 1 5 R
15 RKD 283 (d) Yr7, Yr10, Yr24, Yr64 Yr59 4 1 5 R
16 TL 3006 (T) Yr24, Yr64 Yr18, Yr30 2 2 4 R
17 TL 3007 (T) Yr5, Yr10, Yr15, Yr26, Yr40, Yr47 Yr18, Yr29, Yr30, Yr59 6 4 10 R
18 TL 3008 (T) Yr10, Yr26, Yr64, YrMor Yr29 4 1 5 R
19 TL 3009 (T) Yr10, Yr24, Yr26, Yr47, YrZH84 Yr29, Yr48, Yr59 5 3 8 R
20 UAS 459 (d) Yr10, Yr26, Yr64 Yr29, Yr48 3 2 5 R
21 INFECTOR Yr46 0 1 1 30S
22 HD 3209 Yr5, Yr15, Yr26, Yr47 Yr29, Yr30 4 2 6 ‘10MS
23 HI 1605 Yr10, Yr24, Yr26, Yr40, Yr64 5 0 5 R
24 K 1317 Yr5, Yr10, Yr24, Yr26, Yr40, Yr64 Yr30, Yr46 6 2 8 R
25 WB 2 Yr2, Yr5, Yr7, Yr10, Yr26, YrcH52, Yr64 Yr29, Yr30 7 2 9 R
26 AKAW 4842 Yr7, Yr15, Yr24, Yr26, YrcH52, Yr32, Yr40, Yr64 Yr36 8 1 9 10MS
27 DBW 179 Yr2, Yr7, Yr15, Yr24, YrcH52, Yr40, Yr47, Yr64 Yr16, Yr29 8 2 10 TS
28 DBW 216 Yr2, Yr7, Yr10, Yr15, Yr26, YrCH52, Yr32, Yr40, Yr64, YrMor Yr29 10 1 11 R
29 DBW 217 Yr2, Yr7, Yr15, Yr24, Yr26, YrCH52, Yr40, Yr47, Yr64 Yr16, Yr30 9 2 11 R
30 DBW 219 Yr2, Yr10, Yr15, Yr24, Yr26, Yr32 Yr16, Yr29, Yr46 6 3 9 R
31 DDK 1050 (dic.) Yr2, Yr7, Yr15, Yr24, Yr26, Yr40, YrMor, YrZH84 Yr29, Yr30, Yr59 8 3 11 10MS
32 DDK 1051 (dic.) Yr2, Yr5, Yr7, Yr24, Yr26, YrcH52, Yr47, YrZH84 Yr16, Yr29, Yr30 8 3 11 10MS
33 GW 477 Yr2, Yr10, Yr15, Yr24, YrcH52 Yr30, Yr63 5 2 7 10MS
34 MACS 5044 (dic.) Yr2, Yr15, Yr24, YrCH52, Yr47, Yr64 Yr16, Yr18, Yr29, Yr46, 6 4 10 10MS
35 MACS 5046 (dic.) Yr2, Yr10,Yr15, Yr24, YrcH52, Yr47, Yr64 Yr18, Yr29 7 2 9 10MS
36 NW 6094 Yr2, Yr10, Yr24, YrcH52, Yr47, Yr64 Yr18, Yr48 6 2 8 R
37 PBW 621 Yr2, Yr7, Yr10, Yr15, Yr24, Yr26, YrcH52,Yr64 Yr16, Yr30, Yr48 8 3 11 TS
38 RKD 292 (d) Yr2, Yr7, Yr10,Yr15, Yr24, Yr26, YrcH52, Yr47, YrZH84, Yr64,YrMor 11 0 11 R
39 VL 4001 Yr2, Yr10,Yr15, Yr24, YrcH52, Yr40, Yr47, Yr63, YrMor Yr30 9 1 10 R
40 WH 1215 Yr2, Yr15, Yr24, Yr26, YrcH52, Yr47, Yr64 Yr46 7 1 8 R
41 DBW 220 Yr2, Yr10, Yr15, Yr26, YrCH52, Yr40, Yr64 Yr16, Yr18, Yr30, Yr46 7 4 11 R
42 HPBW 02 Yr2, Yr7, Yr10, Yr15, Yr17, Yr64 Yr18, Yr46 6 2 8 R
43 HPPAU 08 Yr2, Yr10, Yr24, Yr26, YrcH52, Yr64, YrMor Yr16, Yr18, Yr29, Yr30 7 4 11 R
44 HPPAU 10 Yr2, Yr15, Yr24, Yr26, Yr64 Yr16, Yr18, Yr29, Yr30 5 4 9 R
45 HPW 424 Yr2, Yr15, Yr24, Yr26, Yr63, YrMor Yr18, Yr29, Yr30 6 3 9 R
46 HS 627 Yr2, Yr7, Yr10, Yr15, Yr26, Yr64 Yr29, Yr30 6 2 8 R
47 NW 6046 Yr5, Yr7, Yr10, Yr24, Yr26 Yr29, Yr30 5 2 7 R
48 PDW 344 (d) Yr7, Yr10, Yr24, Yr26, YrcH52 Yr29, Yr30, Yr48 5 3 8 R
49 WH 1184 Yr2, Yr5, Yr7, Yr10, Yr26, YrcH52, Yr40, Yr64, YrMor Yr29, Yr30, Yr48 9 3 12 R
50 HS 580 Yr2, Yr5, Yr7, Yr10, Yr26, YrcH52, Yr40, Yr64 Yr18, Yr29, Yr30, Yr46, 8 4 12 R
51 VL 1009 Yr2, Yr7, Yr10, Yr26, YrcH52, Yr32, Yr40, Yr64, YrZH84 Yr16, Yr18, Yr29, Yr30, Yr46, Yr59 9 6 15 R
52 UP 2954 Yr2, Yr7, Yr10, Yr24, Yr26, YrcH52, Yr64, YrZH84 Yr16, Yr29, Yr46, Yr59 8 4 12 R
53 UP 2955 Yr2, Yr7, Yr24, YrcH52, Yr47, Yr48, Yr64 Yr16, Yr46 7 2 9 R
54 VL 3002 Yr5, Yr7, Yr24, Yr26, YrcH52, Yr40, Yr47, Yr48, Yr60, Yr64 Yr16, Yr18, Yr29, Yr30, Yr46 10 5 15 Ts
55 VL 3010 Yr2, Yr5, Yr7, Yr10, Yr15, Yr26, YrCH52, Yr40, Yr47 Yr16, Yr18, Yr29, Yr30, Yr46 9 5 14 R
56 VL 3011 Yr5, Yr7, Yr10, Yr26, YrCH52, Yr40 Yr18, Yr29, Yr30, Yr46 6 4 10 R
57 VL 3012 Yr2, Yr5, Yr10 Yr29, Yr30, Yr46 3 3 6 R
58 WH 1181 Yr2, Yr5, Yr7, Yr10, Yr64 Yr16, Yr29, Yr30 5 3 8 R
59 WH 1216 Yr7, Yr10, YrCH52, Yr64, YrMor Yr16, Yr30 5 2 7 R
60 WH 1310 Yr2, Yr7, Yr10, Yr40 Yr16, Yr30, Yr48 4 3 7 R
61 HD 3171 Yr2, Yr7, Yr10, Yr40, YrMor Yr16, Yr30 5 2 7 R
62 Lassik Yr17, Yr26 Yr18, Yr29, Yr30, Yr36, Yr48 2 5 7 R
63 WH711 Yr16, Yr30 0 2 2 S
64 PBW343 Yr2, Yr26 Yr16, Yr30 2 2 4 S
65 WH542 Yr64 Yr16, Yr18, Yr30, Yr59 1 4 5 R
66 WH1105 Yr2, Yr10 Yr16, Yr30 2 2 4 R
67 HD2967 Yr2, Yr7, Yr24, Yr64 Yr30 4 1 5 S
68 Kharchia Yr7, Yr24 Yr16, Yr30 2 2 4 S

3.3 Molecular identification of Yr2

SSR marker Wmc364 linked to the yellow rust resistance gene is located on chromosome 7B at the distance of 5.6 cM [43]. Wmc364 amplified two alleles (+200 bp/–190 bp) for distinguishing gene positive and negative genotypes. A total of 31 genotypes (45%) amplified 200 bp alleles whereas 16 genotypes (23.5%) amplified both the alleles (HI 8759, HI 8774, HPPAU 05, WB 2, DBW 179, DBW 216, DBW 217, DBW 219, DDK 1050, DDK 1051, MACS 5044, RKD 292, DBW 220, HS 580, VL 3012 and WH 1310). Twenty-one genotypes (30.8%) amplified 190 bp allele (HS 626, RKS 283, TL 3006, TL 3007, TL 3008, TL 3009, UAS 459, Infector, HD 3209, HI 1605, K 1317, AKAW 4842, NW 6046, PDW 344, VL 3002, VL 3011, WH 1216, Lassik, WH 542, Kharchia and WH711). On the basis of screening at genotypic level, 47 genotypes (69.1%) were postulated to carry resistant allele for Yr2 gene. Since the distance between marker and gene is far, it is not recommended for marker assisted breeding.

3.4 Molecular identification of Yr5

Yellow rust resistance gene Yr5, originally derived from Triticum spelta var album [44] is a race-specific R-gene effective at both seedling and all plant growth stages and located on the chromosome 2BL [45]. Four microsatellite markers Xgwm501, Wmc175, Barc349, Barc167 [46] and two STS markers S19M93-100 [47], STS7/8 [48] linked with yellow rust resistance gene Yr5 were used to confirm and evaluate the diagnostic potential of these markers in wheat genotypes. Microsatellite marker Wmc175 and Barc167 failed to yield any amplicons whereas S19M93-140 located at 0.54 cM from Yr5 amplified one 100 bp allele. Screening with S19M93 marker produced the expected 100 bp band associated with Yr5 gene in 30 genotypes (44.1%), while the other 38 wheat genotypes (55.8%) failed to amplify the gene. Another marker STS7/8 is proximally located 0.3 cM from the Yr5 gene and amplified 500 bp bands in 23 genotypes (33.8%) with Yr5 gene. Dominant SSR marker Barc349 is located 0.4 cM distally [48] and amplified 5 alleles (100 bp, 105 bp, 120 bp, 140 bp, 220 bp). Product size 105 bp that is linked with presence of Yr5 gene was observed in 32 lines (47%). SSR marker Xgwm501 is located 10.5–13.3 cM from Yr5 gene [49] and amplified 3 alleles (100 bp, 150 bp, 176 bp). Thirty-one genotypes (45%) produced the expected 176 bp band which indicated that they may contain Yr5. However, the genetic distance between the markers Xgwm501 and Yr5 is too far to be used in marker-assisted selection. On the basis of proximal and distal distance of Yr5 linked markers, 12 genotypes (17.64%) (HS 626, TL 3007, HD 3209, K 1317, DDK 1051, PDW 344, WH 1184, HS 510, VL 3010, VL 3011, VL 3012 and WH 1181) were identified with Yr5 gene.

3.5 Molecular identification of Yr7

Yr7 was first identified in wheat cultivar ‘Lee’ (Triticum turgidum (lumillo durum) [50] and mapped on chromosome 2BL [51]. Yr7 is allelic to Yr5 and linked with Sr9 g [52]. Microsatellite marker Xgwm526 linked with Yr7 locus at 2.3 cM was used to detect the presence of Yr7. Thirty-nine genotypes (57.4%) showed 145 bp fragment associated with the presence of Yr7. The remaining 29 wheat genotypes did not show 145 bp products, indicating likely absence of Yr7. SSR marker CFD77 amplified a 220 bp allele in all the genotypes indicating non-diagnostic behaviour of that marker. Overall 36 genotypes (52.9%) were postulated to harbour the Yr7 gene.

3.6 Molecular identification of Yr9

Yr9, located on the short arm of rye chromosome 1R, was transferred to wheat through chromosomal translocation of 1BL.1RS. Four markers STSSr31[53], Xgwm582, IB267 and Xwgp8 were chosen to amplify Yr9 gene. STS marker Sr31 and RGAP marker Xwgp8 failed to give amplification reactions. Xgwm582 is present on chromosome 1BL at 3.7 cM distance of Yr9 and amplified 150 bp product size in 23 genotypes (33.9%) carrying Yr9 gene [54]. IB267 marker is completely linked at 0 cM [55] and produced Yr9 specific 267 bp bands in 2 genotypes (PBW 723 and HPPAU 05). Based on 2 sets of primer pairs, PBW 723 and HPPAU 05 genotypes amplified both of the primers and were postulated to carry Yr9.

3.7 Molecular identification of Yr10

Dominant gene, Yr10 was isolated from Moro [21] and located on chromosome 1BS, 2 cM apart from Rg1 locus that confers brown glume colour [56] and 5 cM from locus Gli-1B [57]. Microsatellite marker Xpsp3000 located 1.3 cM proximal to Yr10 [58] was used to determine the presence or absence of the gene in wheat genotypes. On screening with marker Xpsp3000, a varied range of allelic variation (220 bp, 240 bp, 260 bp and 285 bp) at Yr10 locus was observed. Thirty-four genotypes produced 260 bp fragment associated with the presence of Yr10 allele [59], 16 genotypes showed 285 bp fragment specific for Yrvav allele [60], 48 genotypes amplified 240 bp fragment specific for susceptible allele. Seven genotypes showed amplification of both 285 and 260 bp allele (Yr10+Yrvav) (K 1317, DBW 216, PDW 344, WH 1184, HS 580, VL 3011, HPBW 02), 15 genotypes amplified both 260 bp and 240 bp alleles (HI 8759, HI 8774, PBW 756, RKD 283, TL 3007, TL 3008, TL 3009, WH 1214, GW 477, UAS 459, MACS 5046, NW 6046, HPPAU 10, WH 542, WH 1105). Five genotypes amplified all four alleles (HPW 423, DBW 179, PBW 621, VL 4001 and HPPAU 08) and 31 genotypes amplified a 220 bp allele in combination with other alleles indicating the presence of a novel allele at Yr10 loci. One Genotype, WB2 was identified carrying 260 bp allele. Both 260 bp and 285 bp bands are associated with the presence of resistance gene. On this basis, 34 genotypes (50.0%) carried Yr10 gene.

3.8 Molecular identification of Yr15

Dominant gene Yr15, derived from Triticum dicoccoides, is located on chromosome 1BS [61]. Murphy et al. [48] showed that Xbarc8 and Xgwm413 were closely linked with Yr15. The Yr15 gene was mapped to a 6.4 cM interval flanked by marker Barc8, located 3.9 cM to the distal side, and by Xgwm413 and Xgwm273 located 2.5 cM and 2.1 cM to the proximal side. Six markers, Xgwm11, Xgwm18, Xgwm 33, Xgwm273, Barc8 and Xgwm413 linked with Yr15 were used for validation purpose. SSR marker Barc8, produced 2 alleles (260 bp and 280 bp), respectively. Thirty genotypes (44.1%) amplified 260 bp bands associated with Yr15 gene while 37 genotypes (54.4%) amplified 280 bp without Yr15 gene. SSR locus Xgwm 413 located 3.5 cM proximally produced 3 alleles (90 bp, 95 bp and 100 bp) among wheat genotypes used in this study. A huge variation in allelic profile of Xgwm413 was observed. Forty-three genotypes amplified 90 bp specific alleles, 64 genotypes amplified 95 bp alleles, 36 genotypes amplified 100 bp alleles, 17 genotypes produced both the 95 bp and 100 bp alleles, 25 genotypes amplified 90 bp and 95 bp alleles and 17 genotypes amplified all the three alleles (90 bp, 95 bp and 100 bp). Xgwm273 marker is present 0.4 cM from Yr15 and amplified 7 alleles (156 bp, 165 bp, 180 bp, 200 bp, 350 bp, 400 bp and 500 bp), respectively. Sixteen genotypes (23.5%) produced 156 bp bands specific for Yr15 [62]. Xgwm11 and Xgwm18 failed to give amplifications. Xgwm33 produced inconclusive results. On the basis of proximal and distal distance of linked markers 25 genotypes (36.7%) (HI 8774, HPPAU 05, HS 628, PBW 725, TL 3007, HD 3209, AKAW 4842, DBW 179, DBW 216, DBW 217, DBW 219, DDK 1050, GW 477, MACS 5044, MACS 5046, PBW 621, RKD 292, VL 4001, WH 1215, DBW 220, HPBW 02, HPPAU 10, HPW 424, HS 627 and VL 3010) were predicted with Yr15.

3.9 Molecular identification of Yr16

Yr16 was originally originated from the French cultivar Capelle-Desprez and mapped on chromosome 2DS. SSR, Xgwm102 corresponding to the QTLs (QYr.ufs-2D) is reported to be linked with gene Yr16 and was used to screen the wheat genotypes [63]. SSR marker, Xgwm249 linked to Yr16 gene showed polymorphism in present investigation with product size ranging from 120 to 160 bp. Since, no specific product size information is available for this marker. Screening results could not be associated with Yr16 gene. Marker Xgwm102 amplified three alleles 150 bp, 155 bp and 200 bp, respectively. Twenty-two wheat genotypes (32.3%) produced the 155 bp and 200 bp allele confirming the likely presence of this gene [63].

3.10 Molecular identification of Yr17

Three rust resistance genes i.e. Yr17, Lr37 and Sr38 were translocated into the short arm of wheat chromosome 2A of bread wheat from 2NS chromosome of Triticum ventricosum [64]. The presence of Yr17 gene in Indian wheat genotypes was investigated with the primers VENTRIUP/LN2 [24]. All the wheat genotypes amplified a 259 bp fragment specific for Yr17 gene, indicating either the presence of Yr17 in all the genotypes or the non-diagnosing behaviour of this marker in the Indian wheat background. Therefore, further confirmation of Yr17 was done with the help of primers URIC/LN2 which amplifies the two fragments of 285 bp (N-allele) and 275 bp (A-allele). Subsequent digestion of the undigested PCR products with restriction enzyme DpnII yields the 275 bp and the 166, 109 bp fragments corresponding to the presence and absence of gene. None of the wheat genotypes, other than the positive control Lassik gave positive restriction digestion results for Yr17 gene, confirming the likely absence of Yr17 gene in this panel of Indian wheat genotypes.

3.11 Molecular identification of Yr18

The presence of yellow rust resistance gene Yr18 was assayed using STS marker csLV34, gene specific marker cssfr2 and SSR marker Xgwm295. The STS marker csLV34 located 0.4 cM distal to Yr18 [65] produced two allelic variants i.e. csLV34b and csLV34ba. The 150-bp band (csLV34b) and 229-bp band (csLV34ba) indicated the presence and absence of Yr18 gene, respectively. Twenty-four genotypes (35.3%) amplified 150 bp fragments, suggesting the presence of Yr18-associated allele. Forty-four genotypes (64.7%) produced 229 bp band associated with csLV34a allele indicating absence of Yr18 gene. The gene specific marker cssfr2 produced 517 bp products with Yr18. Thirty-five genotypes (51.5%) amplified cssfr2 marker. A total of 42 genotypes (61.8%) showed the association with Yr18 gene by using any of the markers while 20 genotypes (29.4%) (HI 8759, HI 8774, HPPAU 05, HPW 423, HPW 433, HS 623, TL 3006, TL 3007, MACS 5044, MACS 5046, NW 6094, HPBW 02, HPW 424, HS 580, VL 1009, VL 3002, VL 3010, VL 3011, Lassik and WH 542) were positive with both the markers. SSR marker Xgwm295 produced variable results and could not be linked with the presence of gene.

3.12 Molecular identification of Yr24/26

Yr24 confers ASR to yellow rust and was originally identified in Tturgidum var. durum accession K733. Yellow rust resistance gene Yr26, carried by T. turgidum durum line and was located on chromosome 1B [66]. Yr26 and Yr24 are considered to be identical genes due to their disease reaction against rust isolates [67]. Two markers Barc181 and Barc187, were used to detect the presence/absence of Yr24/Yr26 genes. The SSR marker Barc187 linked with Yr24 at the distance of 2.3 cM [68], amplified three alleles; 200 bp, 220 bp and 225 bp, respectively. Forty genotypes (58.9%) amplified 200 bp indicating the likely presence of Yr24, whereas 31 genotypes (45.6%) produced 220 bp and 225 bp alleles, without Yr24. Microsatellite marker Xbarc181 is 6.7 cM distal to Yr26 [68] and produced 2 alleles 180 bp and 200 bp, respectively. Thirty-eight genotypes (69.2%) produced 180 bp allele associated with Yr26 gene while 34 genotypes amplified the 200 bp specific allele. Four genotypes (HS623, HS626, DDK1051 and DBW220) amplified both the alleles. Combined results with both the markers exhibited the presence of Yr24/Yr26 in 19 genotypes (27.9%) i.e. HPPAU 05, HPW 423, HS 622, PBW 725, TL 3009, HI 1606, K 1317, AKAW 4842, DBW 217, DBW 219, DDK 1050, PBW 621, WH 1215, HPBW 02, HPPAU 08, HPPAU 10, HS 627, NW 6046 and VL 1009.

3.13 Molecular identification of YrCH52

Xgwm498 located at 1.6 cM produced 160 bp associated with YrCH52 in 25 genotypes (36.7%), EST based marker CON-6 (0 cM) and STS marker CYS-5 (0.5 cM) developed from resistance gene analogues [69] did not produce any results.

3.14 Molecular identification of Yr25

Xgwm6 linked with Yr25 gene produced monomorphic bands of 150 bp in all the genotypes indicating non-diagnosing nature of the primer.

3.15 Molecular identification of Yr27

Yr27, originated from the cultivar McMurachy and is located on chromosome 2BS [70]. The chromosomal region of Yr27 harbours Lr13, Lr23 and Lr31 rust resistance genes. SSR marker Xgwm630 is located 10 cM from Lr13 (Seyfarth et al., 1999). Since, Yr27 is linked with Lr13; Xgwm630 was used to check the abundance of Yr27 gene in wheat genotypes [71]. Xgwm630 primer amplified a 124 bp allele in all the genotypes marking either the 100% abundance of Yr27 or its absence. Nevertheless, the genetic distance (10 cM) is too large for use of Xgwm630 for MAS. Yr27 is an all plant stage resistant gene that shows the durability in combination with Lr34 and other resistance genes [72]; however, as a single gene Yr27, is no longer effective in most wheat growing areas (McIntosh et al., 1995) [73].

3.16 Molecular identification of Yr29

Yr29 was originally identified in cultivar Pavon 76 and was assigned to chromosome 1BL [74]. Yr29 confers moderate level slow-rusting APR to yellow rust. Yr29 gene is closely linked to Lr46 for leaf rust resistance. Wmc44 flanks Yr29 3.6 cM proximally [75] and amplified 8 alleles (205 bp, 210 bp, 220 bp, 240 bp, 260 bp, 280 bp, 300 and 310 bp), respectively. Twenty-six genotypes (38.2%) specific as predicted for (260 bp) with Yr29 and 49 lines (72%) without Yr29 were identified. SSR Xgwm 259 gave inconclusive results.

3.17 Molecular identification of Yr30

Yr30 is a minor APR gene introgressed from Yaroslav emmer wheat into bread wheat along with the stem rust resistance gene Sr2 [76] and is located on chromosome 3BS [77]. Yr30 is closely linked with Sr2 for stem rust resistance and Lr27 for leaf rust resistance [78]. SSR marker Xgwm533 (+120 bp) has been used in MAS for incorporating the Sr2 gene into wheat cultivars (Spielmeyer et al., 2003) hence Xgwm533 can be potentially used to select Yr30 gene containing genotypes. Screening with Xgwm533 amplified 5 alleles 100 bp, 120 bp, 130 bp, 140 bp and 150 bp, respectively. Forty-six genotypes (67.6%) produced 120 bp bands specific for Yr30 while 10 genotypes (14.7%) failed to yield any amplicons. CAPS marker csSr2 failed to amplify any of the genotypes.

3.18 Molecular identification of Yr32

Yr32 was originally detected from cultivar Carstens V [79] and is located on chromosome 4D. SSR marker WMC198 is closely linked to Yr32 at 0.2 cM [80] and amplified two alleles 180 bp and 200 bp, respectively. Six genotypes (8.8%) (HD 3209, AKAW 3842, DBW 216, DBW 219, RKD 292 and VL 1009) produced bands associated with Yr32 while the remaining genotypes failed to amplify the gene.

3.19 Molecular identification of Yr35

Yr35 confers effective all-stage resistance. It was derived from Tdicoccoides and was located on chromosome 6BS [81]. SSR marker cfd1 located at 4.1 cM from Yr35 and 3.0 cM to Lr53 gene didn’t amplify in any of the genotypes indicating absence of Yr35 gene in all genotypes.

3.20 Molecular identification of Yr36

Yr36 is derived from T. turgidum ssp. dicoccoides accession FA15-3 and confers high level of HTAP resistance. It is located on chromosome 6B. Three primers, ASA at 0.3 cM [82], SSR Barc101 [82] at 2 cM and WKS1 (gene based) [83] linked with Yr36 were used to screen the wheat genotypes. ASA primer amplified 1.6 kb product size in 3 genotypes (4.5%) i.e. HPPAU 05, AKAW 3842 & Lassik. Barc101 amplified 5 alleles 116 bp, 124 bp, 138 bp, 160 bp and 165 bp respectively. Twenty-seven genotypes (39.7%) produced a 165 bp band associated with Yr36. Remaining genotypes showed absence of this allele. WKS1 is HTAP gene-based marker and amplified 128 bp product sizes in two genotypes (HPPAU 05 and Lassik).

3.21 Molecular identification of Yr40

Yr40 originated from ovate goat grass, Ae. geniculata Roth (syn. Ae. ovata L.) is located on chromosome 4D and confers effective ASR to yellow rust. Yr40 and Lr57 was either closely linked genes or they are the same gene with pleiotropic effect [84]. SSR Xfbb276 amplified 1 kb and 2 kb alleles in 20 lines (29.4%) indicating likely presence of Yr40.

3.22 Molecular identification of Yr46

Yr46 confers APR to yellow rust and is located in the middle of chromosome 4DL. Cfd71 and Cfd23 markers are associated with Lr47 gene [85]. Cfd71 amplified 3 alleles 148 bp (+), 150 bp and 152 bp while Cfd23 amplified two alleles of 214 bp and 211 bp in 20 genotypes (29.4%). On the basis of both primers 13 genotypes (19.1%) (K 1317, DBW 219, MACS 5044, WH 1215, DBW 220, HPBW 02, HS 580, VL 1009, UP 2954, UP 2955, VL 3002, VL 3011 and VL 3012) identified with Yr46 gene.

3.23 Molecular identification of Yr47

Yr47 (YrW1) originated from Iranian wheat landraces and was located on chromosome 5BS [86]. SSR marker cfb309, estimated to be about 8–12 cM from Yr47. Yr47 is linked with leaf rust resistance gene Lr52 with a genetic distance of 3–6 cM [86]. Cfb309 amplified 2 alleles of 350 bp and 600 bp. Allele 600 bp is associated with the presence of Yr47 and was found in 6 genotypes (8.8%) while 15 genotypes (22.05%) produced both alleles indicating heterozygosity of the gene. Four genotypes (5.8%) produced 350 bp allele confirming absence of this gene. Remaining genotypes didn’t amplify any product. Twenty-one genotypes (30.9%) are presumed to include the Yr47 gene.

3.24 Molecular identification of Yr48

Yr48, derived from wheat genotype PI610750 is a QTL conferring APR to yellow rust and located on chromosome 5AL [87]. Marker-assisted breeding programs uses closely linked markers SNF-A2 (0.18 cM proximal of Yr48), BE495011 (0.09 cM proximal of Yr48) and cfa2149 (0.06 cM distal of Yr48) for selection of Yr48 gene. SSR cfa2149 produced 2 alleles of 225 bp and 250 bp. Twenty-two Genotypes (32.4%) showed both 225 bp and 250 bp alleles, 2 genotypes (2.9%) showed 225 bp, 2 genotypes (2.9%) showed 250 bp alleles. SNF-A2 amplified 3 alleles of 150 bp, 180 bp and 220 bp. Two genotypes (2.9%) (TL 3009, UAS 459) produced 150 bp alleles and were associated with Yr48. Two genotypes (2.9%) gave 180 bp and 220 bp alleles, five genotypes produced 180 bp allele and eight genotypes produced 220 bp allele. BE495011 amplified one allele of 220 bp in 18 genotypes (26.5%) confirming presence of this gene. Overall 32 genotypes (48.5%) confirmed positive with all these markers. Combining proximal and distal position, 12 genotypes (17.6%). HI 8759, HI 8774, HPW 433, UAS 459, NW 6094, PBW 621, PDW 344, WH 1184, UP 2955, WH 1310 and Lassik were postulated to carry Yr48.

3.25 Molecular identification of Yr51

Yr51 is recessive in nature and confers ASR to yellow rust. Yr51 is delimited by markers owm45F3R3 at 1.2 cM proximal and sun104 at 2.5 cM distal, respectively, locating Yr51 on the long arm of chromosome 4B. Since, Yr51 is not present in modern wheat genotypes, positive validation was not feasible. Marker sun104 amplifies 225 bp in resistant lines and a null in susceptible lines. Negative validation using sun104 produced null allele in all 68 genotypes confirming absence of Yr51 gene. Marker owm45F3R3, amplified in 10 genotypes (14.8%). Since, no earlier data on this marker is available this marker was considered unsuitable for diagnostic purpose. Therefore, sun104 can be used for marker-assisted selection of Yr51 in wheat genotypes lacking the resistance linked 225 bp allele. Marker assisted detection for Yr51 revealed the absence of this gene in Indian wheat genotypes. Similar results were obtained by Randhawa et al. [27].

3.26 Molecular identification of Yr59/YrZH84

Yr59, identified from an Iraqi spring wheat landrace, PI 178759, codes for HTAP resistance and is located on chromosome 7BL [28]. SSR locus Xbarc32, located proximal to Yr59 (< 2.1 cM) produces a 165 bp product in the resistant line and a 175 bp product in the susceptible line. On screening with this primer, 4 alleles were amplified 165 bp (+), 175, 190 bp and 250 bp, respectively. Eleven genotypes (16.2%) were found to contain this gene, while the remaining genotypes did not amplify the 165 bp allele associated with Yr59. On the distal side Xwmc 557 is located (> 2.2 cM). Screening with this primer amplified 2 alleles, 315 bp and 500 bp. Thirteen genotypes showed presence of this gene indicating 19.2% polymorphism rate. Over all 17, genotypes (25%) amplified either of the primers while 4 genotypes (HI 8759, DDK 1050, VL 1009 and UP 2954) showed amplification with both of these primer pairs.

3.27 Molecular identification of Yr60

Yr60 (YrLalb) resistance gene is developed from the Mexican wheat line ‘Almop’ (Wiliam et al., 2003) [88] and located on the distal end of chromosome arm 4AL. This gene confers moderate resistance at both the seedling and the adult-plant stages. SSR locus wmc776 located < 0.6 cM away amplified 3 alleles 150 bp, 160 bp and 170 bp respectively. Fourteen genotypes (20.6%) amplified this gene with 150 bp, 160 bp and 170 bp respectively. Wmc313 is located 0.6 cM distal to Yr60 and amplified 180 bp and 200 bp alleles in 20 genotypes (29.3%) whereas wmc219 which is also located 0.6 cM to Yr60 amplified 200 bp and 220 bp alleles in 16 genotypes (23.6%). Remaining genotypes didn’t amplify any product confirming absence of this gene. Combined results using all the markers predicted Yr60 in HI 8774 (d).

3.28 Molecular identification of Yr64

Yr64 confers ASR to yellow rust and is located on chromosome 1BS. SSR Xgwm413 is linked to Yr64 gene distally at 3.5cM [30]. Screening of wheat genotypes with Xgwm413 led to the amplification of 95 bp allele in 42 genotypes, predicting its likely presence in the Wheat breeding lines.

3.29 Molecular identification of YrMor

S26M47 amplified 250 bp product size associated with the presence of the gene in 10 genotypes (14.8%) i.e. HPPAU 05, HPW 433, PBW 760, TL 3000, DBW 316, VL 4001, HPPAU 08, WH 1216 & HD 3171.

PM47 marker specific for YrHua gene, Xgwm410 specific for YrCN19/Yr41, WMC631 specific for YrExp1 gene and WMC441 associated with YrSPp gene did not produce any result confirming either the absence of this gene in wheat genotypes or non-diagnostic behaviour of markers used for the screening purposes. RGAP markers linked with Yr9, Yr45 also didn’t yield satisfactory results may be due to non-specificity of the markers in diverse wheat background. Electrophoretograms of various Yr genes are given in Fig. 1.

Fig. 1

Electrophoretogram of the primers for different Yr resistance genes. The corresponding Primers of Yr2, Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr24, Yr26, Yr29, Yr30, Yr36, Yr46, Yr47, Yr48, Yr59, Yr60, and YrZH84 were used to screen the elite wheat lines and varieties (A–Z). Although no control accession was used, the postulated bands were easy to be distinguished according to previously reported base pairs of the PCR product. The presence or absence of gene is marked with an arrow. Note: M1, 20 bp DNA Ladder (Fermentas life sciences); M2: 100 bp Ladder (G Biosciences).

4 Discussion

The severe yellow rust problem on the predominant wheat varieties of India is due to the excessive dependence on seedling resistance genes Yr2, Yr9 and Yr27 in isolation from other APR genes and absence of major avirulent (Yr10, Yr15 & Yr24/Yr26) genes in the adopted varieties. Rapid evolving and virulent races of Pst have overcome the resistance of these major single genes deployed in widely cultivated varieties with the passage of time [89]. The breakdown of resistance has alarmed wheat breeders in the need for broadening the genetic base of future Indian wheat varieties by incorporating multiple yellow rust resistance genes. Identification of novel genes for yellow rust resistance can help breeders to efficiently and accurately incorporate those genes into breeding material by MAS to reduce the disease incidences. Deployment of specific gene combinations provides durable and improved resistance versus using single genes because single specific gene is subject to become susceptible due to genetic shifts in the pathogen [90]. Therefore, 70 closely linked markers specific for 35 Yr genes were used to detect the likely presence of Yr genes among the wheat genotypes and evaluate their contribution to the current status of Pst resistance. Most of the genes were amplified by using 1–5 linked markers for better accuracy of results. The combined results of all the markers were used for confirming the presence of genes. However, those markers which are gene based have better accuracy and can be considered alone for evaluation of resistance genes in wheat breeding programmes. Our molecular screening results correlated with the published reports for the size of expected PCR product and provides useful information for choosing specific resistant genes and an opportunity to pyramid the resistant genes against Pst pathotypes in a single wheat genotype. Out of 35 Yr genes, 25 genes amplified in wheat genotypes under study. The distribution of 25 Yr resistance genes among 68 wheat genotypes is illustrated in Fig. 2.

Fig. 2

Percent contribution of Yr genes to the total resistance in wheat genotypes.

Two genotypes (VL 1009 & VL 3002) were identified with maximum 15 Yr genes followed by 14 genes in VL 3010 and HI 8759, respectively. Both of these genotypes exhibited resistance response at field level. Most 11 seedling resistance genes were identified in RKD 292 followed by 10 genes in DBW 216, WH 1184 and VL 3002 while most six APR genes were identified in HI 8759 and VL 3009 followed by five genes in, Lassik respectively. Even though RKD292 contained the major Yr genes (Yr10, Yr15, Yr24 & Yr26) and none of the APR gene, it still exhibited resistance response at field level concluding the major effects of these genes. Lowest numbers of two Yr genes were detected in genotypes PBW 757 and WH 711 susceptible genotypes. No major Yr genes were identified in susceptible genotypes. None of the RS/ASR genes were identified in genotype WH 711 while PBW 757 had one gene, followed by two genes in TL 3006, WH 1105, Kharchia and PBW 343 genotypes, respectively. Genotypes (HI 1605 and RKD 292) were identified with none of the APR genes but presence of Yr10, Yr24 & Yr26 imparted resistance response at field testing.

The genotypes carrying multiple Yr genes might be useful for pyramiding Pst resistance sources into commercial varieties [35]. The ratio of RS and APR genes to the total resistance among wheat genotypes is illustrated in Fig. 3. The higher frequency of RS genes over APR genes in Indian genotypes indicates an erosion of APR genes resulting from preferred use of dominant RS and ASR genes which were easier to select and breed into existing crop cultivars in Indian breeding programs. Genes Yr26 (69.2%), Yr2 (69.1%), Yr64 (61.7%), Yr24 (58.9%), Yr7 (52.9%), Yr10 (50%) and Yr 48 (48.5%) showed high frequency among our panel of wheat genotypes, while Yr9 (2.94%), Yr36 (2.94%), Yr60 (1.47%) and Yr32 (8.8%) were least frequent in wheat genotypes (Fig. 4). Similar frequency of Yr genes among genotypes was observed in previous studies [18,91]. Zheng et al. [16] also studied the molecular characterisation of 330 leading wheat cultivars and 164 advanced breeding lines in China and identified Yr9, Yr17, Yr18 and Yr26 in 134 (29.4%), 45 (9.1%), 10 (2%) and 15 (3%) entries, respectively.

Fig. 3

Contribution of all-stage resistance genes (RS) and adult-plant resistance (APR) genes in wheat genotypes.

Fig. 4

Abundance of individual Yr genes in wheat genotypes.

Yr5 is found to be effective against all rust virulent races in North America [7,20,92], Iran, China [7,93], India and Turkey [94]. Yr5 gene is still resistant to major races in India and has potential to become an effective source of yellow rust resistance if deployed in combination with other R-genes. On screening with S19M93 marker specific for Yr5 gene, polymorphic rate of 44.1% was observed among wheat genotypes. Ullah et al. [32] obtained 89% polymorphic rate of Yr5 gene in 99 Pakistan wheat lines on screening with S19M93 molecular marker. Our findings for Yr5 gene were also in accordance with the screening results of Iqbal et al. [33]. On the basis of combined results of the entire Yr5 markers, all of the Yr5 gene containing twelve genotypes (TL3007, K1317, WB2, NW6046, WH1184, HS580, VL3010, VL3011, VL3012, WH1181, HD3209, DDK1051 & VL3002) showed fairly good to moderate resistance response at field testing. A total of 52.9% genotypes showed the presence of Yr7 gene. Yr7 is known to be allelic to Yr5 and linked with stem rust Sr9 g gene [52]. These genotypes can be further tested against stem rust pathotypes to be used as donor in stem rust breeding programmes. Yr10 gene has also been reported to be effective against all races in India, Pakistan, China, Iran and USA [95]. Bariana et al. [60] reported two alleles for Yr10 i.e. Yr10 and Yrvav and described that varieties with Yr10 amplify a 258–260 bps fragment, 285 bp with Yrvav allele and 240 bp for lacking the Yr10 gene. In our study, a 220 bp allele was also identified among the thirty-one wheat genotypes. Yaniv et al. [96] also reported the presence of 220 bp in Pakistani wheat varieties and linked it to the Yr10 resistance gene. Totally, 50% genotypes exhibited the presence of Yr10 resistant allele. Most of the Yr10 alleles co-segregated together indicating the heterozygosity of Yr10 locus. Similar, heterozygous pattern was reported in 28% varieties using Xpsp3000 marker by Talha et al. [97]. However, close genetic distances have been reported to exist between reported marker gene combinations. Though the chance of recombination is very low but could not be neglected. Therefore, the allelic variability among genotypes also emphasizes the need of gene-based markers for efficient selection in marker assisted programmes. A close association between Xpsp3000 marker and Gli-B1 gene has also been reported [57]. Gli-B1 encodes a wheat storage protein which improves plant resistance to abiotic stresses. This association of Yr10vav and Yr10 with specific alleles of Gli-B1 and Xpsp3000 can be useful in marker-assisted selection and gene pyramiding. Marker validation depends on effective marker/trait linkage. To further validate the presence of Yr5 and Yr10, an independent F2 population can be developed from cross between positive parents and a highly susceptible line which can be tested for phenotypic segregation in field and genotypic segregation by proposed markers for respective genes.

The Lr34/Yr18 gene for rust resistance has been used in agriculture for centuries. In contrast to many other resistance sources against leaf rust and stripe rust, it has remained effective and no virulence has been reported. In our study, the frequency of Yr18 allele (29.4%) seemed to be comparatively higher in Indian breeding lines than the previously reported studies. All the genotypes exhibited resistant response at field testing. One genotype, MACS 5046 showed moderate response. Wu et al. [98] found that many Chinese wheat landraces that were predicted to possess the Yr18 resistance allele by marker assays were highly susceptible to yellow rust in the field. This indicated that such landraces either contained susceptible allelic variations at the Yr18 locus or a suppressor of gene function. Yang et al. [99] identified Lr34/Yr18 genes in 231 Chinese wheat cultivars and 422 landraces using the STS marker csLV34 with a frequency of 6.1% and 89.6% respectively. Similarly, Alma et al. [100] characterized elite wheat germplasm from Central Asia using molecular markers linked to the Lr34/Yr18 and found a 16.7% frequency of the csLV34b-allele. As this gene complex provides durable adult-plant resistance, its deployment should be increased in future wheat varieties of India so that their genetic base can be broadened against the continually evolving new races of P. striiformis tritici.

Yr24, Yr26 and YrCH42 are considered to be identical genes due to their similar infection types against rust isolates [67]. Combined results with markers exhibited the presence of Yr24/Yr26/YrCH52 in 19 genotypes (27.9%). All these genotypes exhibited significant lower ACI values. Yr24/Yr26/YrCH52 imparts race specific seedling resistance therefore, in wheat breeding programs; it should be used in combination with other major or minor resistance genes. Yang et al. [101] suggested the importance of gene pyramiding in improvement of durability of rust resistance.

Marker assisted detection for Yr51 using negative validation by sun104 marker revealed the absence of this gene in Indian wheat genotypes. Similar results were obtained by Randhawa et al. [27]. The genetic association of yellow rust resistance with other traits also allows indirect or direct selection for resistance in breeding. Examples include Yr18/Lr34/Sr34, Yr9/Lr26/Sr31, Yr17/Lr37/Sr38, Yr18/Lr34/Pm38, Yr29/Lr46, Yr40/Lr57 and Yr46/Lr67/Sr55. Yr60 gene was identified in one genotype HI 8774 (d). Apart from Yr60 gene, Wmc219 and Wmc313 markers are also linked with leaf rust resistance gene (Lr28) and Septoria tritici blotch resistance gene (Stb7) at 5 cM [102] and 0.5–1.1 cM, respectively [103]. Genotype, HI 8774 can be tested at field level for the presence of leaf rust and septoria blotch resistance for durable rust breeding programmes.

Lines with these genes can be utilised alone or in combination with other ASR and APR genes containing lines. This type of resistance has been used in CIMMYT programs for improvement of leaf rust resistance) [104]. Some genotypes showed good frequency of APR genes such as Yr18 (29.4%) loci which also coincides with leaf rust, stem rust and powdery mildew disease resistance locus, Yr 30 (67.6%), Yr 59 (19.2%) and Yr46 (19.1%). Disease severity response was recorded from resistant to moderate susceptible (0–10 MS) among the genotypes containing these APR genes. Yr30 is a minor APR gene and is closely linked with Sr2 for stem rust resistance and Lr27 for leaf rust resistance [78]. Forty-six genotypes (67.6%) postulated with Yr30 showed effective resistance in the field testing. Since Yr30 is linked with Sr2, it can be effective source in stem rust breeding programmes. Yr46 is a pleiotropic gene and confers APR to yellow rust. It is also known to confer resistance to stem rust (Sr55), leaf rust (Lr67), powdery mildew (Pm46) and also leaf tip necrosis (Ltn3) [105]. The frequency of Yr46 gene was found to be 19.1% among wheat genotypes. Genotypes MACS5044, DBW219, K1317, DBW220, HS580, HPBW02, UP2954, WH1215, VL1009, UP2955, VL3002, VL3010, VL3011 and VL3012 were found to be carrying Yr46 and exhibited resistant to moderate field response. Yr46 is widely distributed in older, tall wheat landraces from Punjab regions in India and Pakistan before modern wheat cultivars were grown in this region and was effective in field tests in Pakistan, India, Mexico and Australia and displayed durable resistance [106]. Yr40 and Lr57 is the same gene with pleiotropic effect [84]. Twenty genotypes (29.4%) HI8774, HS626, TL3007, HI1605, K1317, AKAW4842, DBW179, DBW216, DBW217, VL4001, DBW220, WH1184, HS580, VL1009, VL3002, VL3010, VL3011, DDK1050, WH1310 AND HD3171) indicating likely presence of Yr40.

Non-race-specific Yr59 gene, confers a high level of HTAP resistance (IT 2) and is effective against all tested North American Pst races [26]. Eleven genotypes (WH 542, UP 2954, VL 1009, DDK 1050, TL 3009, RKD 283, PBW 760, PBW 757, PBW 723 and HI 8759) identified with Yr59 can be used to strengthen durable breeding programmes. Yr48, is another QTL which confers APR to yellow rust. Twelve genotypes (17.6%) HI 8759, HI 8774, HPW 433, UAS 459, NW 6094, PBW 621, PDW 344, WH 1184, UP 2955, WH 1310 and Lassik were postulated to carry Yr48. An APR gene imparts durable resistance when pyramided together. Hussain et al. [107] showed that genotypes with combinations of slow rusting genes such as Yr18, Yr29 and Yr30 were high yielding with better resistance. This combination is very interesting as it provides protection against three types of rusts (Leaf rust, yellow rust and stem rust). In our study, out of 68 genotypes, ten genotypes (HI 8759 (d), HPPAU 08, HPPAU 10, HPW 424, HS 580, VL1009, VL3002, VL3010, VL3011 and Lassik) showed the combination of three designated slow rusting/durable genes (Yr18+Yr29+Yr30). All these ten genotypes also showed immune response at field testing. Asghar et al. [108] studied the stacking effect of combination of yellow and leaf rust resistance genes Yr18/Lr34, Yr17/Lr37, Yr29/Lr46 and Lr47 in 50 spring wheat genotypes using PCR based markers. Yr18/Lr34 gene or loci was observed in 39 genotypes, Yr17/Lr37 in 43 genotypes, Yr29/Lr46 in 33 genotypes and Lr47 was found in 34 wheat genotypes, respectively which exhibited better response towards rust diseases. Our results also showed similar trend with these findings. Madenova et al. [109] identified one genotype with Lr34/Yr18 genes and two genotypes with complex genes Lr37/Sr38/Yr17 using csLv34 and VENTRIUP/LN2 primers. Zheng et al. [36] demonstrated the significant additive effect of Yr9 + Yr18 gene combination in Chinese wheat genotypes. One genotype, HPPAU 05 was identified with the gene combination of Yr9+Yr18 displaying effective resistance at field testing.

IB267, the translocation carrying resistance gene Sr50 was transferred from Imperial rye into wheat in chromosome 1BL.1RS and 1DL.1RS [55]. It was found to be effective against stem rust race Ug99 and is being used in various Australian wheat breeding program [110]. In our study, two genotypes (PBW 723 & HPPAU 05) were identified with IB267 translocation, which can be useful for incorporating stem rust resistance in wheat breeding programmes. Yr36 is an HTAP gene which is closely linked to Grain protein content gene (Gpc-B1). Two genotypes AKAW 4842 and HI 8774, along with positive control Lassik were found to be carrying Gpc-B1 allele. Genotype HI 8774 also showed linkage with WKS1 gene. These genotypes can be directly utilised in bio-fortification and durable resistance breeding programme.

Among race specific genes Yr5, Yr10, Yr15, Yr24 and Yr26 are still protective against current predominant races in India. Breeding lines containing these genes can be utilised directly in resistance breeding. By analysing the molecular evaluation data, one genotype (VL 3010) was identified with Yr5, Yr10, Yr15 and Yr26 genes. Six genotypes (VL 3011, HS 626, K 1317, WB 2, WH 184 and HS 580) were identified positively for Yr5, Yr10 and Yr24/Yr26 genes. Eight genotypes (PBW 725, AKW 4842, DBW 179, DBW 217, DDK 1050, VL 4001, WH 1215 and HPW 424) showed the presence of Yr15 and Yr24/26 genes. All these lines displayed high immune response at field testing. Moreover, the genotypes with multiple Yr genes identified in this study might be useful as parental lines for diversifying Pst resistance sources in wheat breeding. Indeed, Yr15 gene has been combined with Yr24 and Yr5 in all the commercial varieties in California covering 14% of the acreage of common wheat and proved to be very useful in controlling the yellow rust epidemics in California. The stacking of genes also has not shown any negative traits associated with the introgression of either of these genes [96]. Several combinations of Yr gene such as (Yr5, Yr9, Yr18, Yr26, Yr29), (Yr10, Yr17, Yr18, Yr26, Yr29), (Yr10, Yr17, Yr18, Yr26, Yr29) and (Yr5, Yr10, Yr18, Yr26, Yr29) was also reported by Begum et al. [111] in Pakistani wheat lines.

Out of 53 parental lines showing field resistance, 9 lines PBW723, HS622, HS623, PBW757, PBW760, TL3006, UP2955, Lassik and WH542 showed a resistant response to yellow rust races but molecular studies indicates these genotypes do not carry Yr5, Yr10 and Yr15. Genotype, PBW 757 showed least number of Yr genes but exhibited immune response in field testing. For genotypes, exhibiting positive reaction in the field for rust resistance but not showing likely presence of major rust resistance Yr5, Yr10 and Yr15 genes, must be having other effective combination of ASR and APR genes or other effective genes which could not be detected with the linked markers used in the study or lack the corresponding allele which could be as a result of genetic recombination [112].

5 Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Compliance with ethical standards

Disclosure of interest

The authors declare that they have no competing interest.

Acknowledgments

We sincerely acknowledge Chaudhary Charan Singh Agricultural University, Hisar, Haryana, India for providing financial support and the facilities to carry out this research work.


References

[1] A.M. Wan; Z.H. Zhao; X.M. Chen et al. Wheat stripe rust epidemic and virulence of Puccinia striiformis f. sp. tritici in China in 2002, Plant Dis., Volume 88 (2004), pp. 896-904

[2] W. Chen; C. Wellings; X. Chen; Z. Kang; T. Liu Wheat stripe (yellow) rust caused by Puccinia striiformis f. sp. tritici, Mol. Plant Path., Volume 15 (2014), pp. 433-446

[3] P.K. Gupta; J. Kumar; R.R. Mir; A. Kumar Marker assisted selection as a component of conventional plant breeding, Plant Breed. Rev., Volume 33 (2009), pp. 145-217

[4] M. Prashar; S.C. Bhardwaj; S.K. Jain; D. Datta Pathotypic evolution in Puccinia striiformis in India during 1995-2004, Aust. J. Agrit. Res., Volume 58 (2007), pp. 602-604

[5] M.S. Saharan; A.K. Sharma; S.S. Singh; M. Singh in: Borlaug Global Rust Initiative 2010 Technical Workshop, St. Petersburg, Russia (2010), p. 31

[6] D.P. Hodson Shifting boundaries: challenges for rust monitoring, Euphytica., Volume 179 (2011), pp. 93-104

[7] X. Chen Epidemiology and control of stripe rust (Puccinia striiformis f. sp. tritici) on wheat, Can. J. Plant Pathol., Volume 27 (2005), pp. 314-337

[8] M.S. Saharan; S. Kumar; R. Selvakumar; I. Sharma Wheat crop health report of Feb-March 2013, Directorate of Wheat Research, Karnal. Wheat Crop Health Newsl., Volume 20 (2015), pp. 1-7

[9] H. Khan; O.P. Gangwar; P. Prasad; S.C. Bhardwaj Mehtaensis Newsl., 36 (2016) no. 1

[10] V.C. Sinha; M. Parashar; R.K. Sharma Profile of yellow rust pathotypes prevalent in the northern plains of india and the resistance genes to counter them, SABRAO J. Breed Genet., Volume 38 (2006), pp. 59-62

[11] D. Pal; S.C. Bhardwaj; D. Sharma; S. Kumari; M. Patial; Vinod; P. Sharma Assessment of genetic diversity and validating rust resistance gene sources using molecular markers in wheat (triticum aestivum L.), SABRAO, J. Breed. Genet., Volume 47 (2015), pp. 89-98

[12] S.C. Bhardwaj; O.P. Gangwar; P. Prasad; H. Khan Mehtaensis Newl., 34 (2014) no. 2

[13] C. Xiang; J. Feng; M. Wang; X. Chen; D.R. See; A. Wan; T. Wang Molecular mapping of stripe rust resistance gene Yr76 in winter club wheat cultivar Tyee, Phytopathology, Volume 106 (2016), pp. 1186-1193

[14] F. Lin; X.M. Chen Genetics and molecular mapping of genes for race specific and all-stage resistance and non-specific high temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa, Theor. Appl. Genet., Volume 114 (2007), pp. 1277-1287

[15] G. Roebbelen; E.L. Sharp Mode of inheritance, interaction and application of genes conditioning resistance to yellow rust, Fortschritte der Pflanzenzuechtung., Volume 9 (1978), pp. 1-88

[16] J.M. Zheng; Z.H. Yan; L. Zhao; S.Z. Li; Z.Y. Zhang; R. Garry; W.Y. Yang; Z.J. Pu Molecular mapping of a stripe rust resistance gene in wheat line C51, J. Genet., Volume 93 (2014), pp. 443-450

[17] J.G. Ellis; E.S. Lagudah; W. Spielmeyer; P.N. Dodds The past, present and future of breeding rust resistant wheat, Front. Plant Sci., Volume 5 (2014), p. 641

[18] S. Tabassum; M. Ashraf; X.M. Chen Evaluation of Pakistan wheat germplasms for stripe rust resistance using molecular markers, Sci. China Life Sci., Volume 53 (2010), pp. 1123-1134

[19] S. Farrakh; S. Khalid; N. Rafique; N. Riaz; A. Mujeeb-Kazi Identification of stripe rust resistant genes in resistant synthetic hexaploid wheat accessions using linked markers, Plant. Genet. Res., Volume 14 (2016), pp. 219-225

[20] X. Chen; M.A. Soria; G. Yan; J. Sun; J. Dubcovsky Development of sequence tagged site and cleaved amplified polymorphic sequence markers for wheat stripe rust resistance gene Yr5, Crop. Sci., Volume 43 (2003), pp. 2058-2064

[21] L. Wang; J. Ma; R. Zhou; X. Wang; J. Jia Molecular tagging of the yellow rust resistance gene Yr10 in common wheat, P.I. 178383 (Triticum aestivum L.), Euphytica., Volume 124 (2002), pp. 71-73

[22] J.H. Peng; T. Fahima; M.S. Röder; Q.Y. Huang High density molecular map of chromosome region harboring stripe rust resistance genes YrH52 and Yr15 derived from wild Emmer wheat Triticum dicoccoides, Genetica., Volume 109 (2000), pp. 199-210

[23] X.J. Zhang; D.J. Han; Q.D. Zeng; Y.H. Duan; F.P. Yuan; J.D. Shi; Q.L. Wang; J.H. Wu; L.L. Huang; Z.S. Kang Fine mapping of wheat stripe rust resistance gene Yr26 based on collinearity of wheat with Brachypodium distachyon and rice, PloS. One, Volume 8 (2013), p. e57885

[24] M. Helguera; I.A. Khan; J. Kolmer; D. Lijavetzky; L. Zhong-qi; J. Dubcovsky PCR assays for the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red spring wheat lines, Crop. Sci., Volume 43 (2003), pp. 1839-1847

[25] P. Smith; R. Koebner; L. Boyd The development of a STS marker linked to a yellow rust resistance derived from the wheat cultivar Moro, Theor. Appl. Genet., Volume 104 (2002), pp. 1278-1282

[26] X.L. Zhou; D.J. Han; X.M. Chen; H.L. Gou; S.J. Guo; L. Rong; Q.L. Wang; L.L. Huang; Z.S. Kang Characterization and molecular mapping of stripe rust resistance gene Yr61 in winter wheat cultivar Pindong 34, Theor. Appl. Genet., Volume 127 (2014), pp. 2349-2358

[27] M. Randhawa; U. Bansal; M. Valarik; B. Klocova; J. Dolezel; H. Bariana Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat, Theor. Appl. Genet., Volume 127 (2014), pp. 317-324

[28] X.L. Zhou; M.N. Wang; X.M. Chen; Y. Lu; Z.S. Kang; J.X. Jing Identification of Yr59 conferring high-temperature adult-plant resistance to stripe rust in wheat germplasm PI 178759, Theor. Appl. Genet., Volume 127 (2014), pp. 935-945

[29] M. Liu; L.J. Szabo; S. Hambelton; Y. Anikster; J.A. Kolmer Molecular phylogentic relationships of the brown leaf rust fungi and on wheat, rye, and other grasses, Plant Dis., Volume 97 (2013), pp. 1408-1417

[30] P. Cheng; L.S. Xu; M.N. Wang; D.R. See; X.M. Chen Molecular mapping of genes Yr64 and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260 and PI 480016, Theor. Appl. Genet., Volume 127 (2014), pp. 2267-2277

[31] H. Randhawa; B.J. Puchalski; M. Frick; A. Goyal; T. Despins; R.J. Graf; A. Laroche; D.A. Gaudet Stripe rust resistance among western Canadian spring wheat and triticale varieties, Can. J. Plant Sci., Volume 92 (2012), pp. 713-722

[32] N. Ullah; N. Ali; M. Iqbal; Aziz-ud-Din; A. Hussain; S. Inayat; Ur. Rahman; H. Ahmad; Inamullah; G.M. Ali Markers assisted selection for multiple stripe rust resistance genes in spring bread wheat lines, Int. J. Biol., Volume 8 (2016), pp. 63-74

[33] M. Iqbal; M. Ejaz; I. Ahmed; A. Shahzad; G.M. Ali Molecular genetic variation for stripe rust resistance in spring wheat, Pak. J. Agric. Sci., Volume 53 (2016) no. 1, pp. 143-150

[34] S. Kumar; S. Archak; R.K. Tyagi; J. Kumar; V.K. Vikas; S.R. Jacob; K. Srinivasan; J. Radhamani; R. Parimalan; M. Sivaswamy; S. Tyagi; M. Yadav; J. Kumari; D.S. Sharma; I. Bhagat; M. Meeta; N.S. Bains; A.K. Chowdhury; B.C. Saha; P.M. Bhattacharya; J. Kumari; M.C. Singh; O.P. Gangwar; P. Prasad; S.C. Bharadwaj; R. Gogoi; J.B. Sharma; G.M.S. Kumar; M.S. Saharan; M. Bag; A. Roy; T.V. Prasad; R.K. Sharma; M. Dutta; I. Sharma; K.C. Bansal Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases, Plos One., Volume 11 (2016) no. 12, p. e0167702 | DOI

[35] Q.D. Zeng; D.J. Han; Q.L. Wang; F.P. Yuan; J.H. Wu; L. Zhang; X.J. Wang; L.L. Huang; X.M. Chen Stripe rust resistance and genes in Chinese wheat cultivars and breeding lines, Euphytica., Volume 196 (2014), pp. 271-284

[36] S. Zheng; Y. Li; L. Lu; Z. Liu; C. Zhang; D. A.O.; Li. Lirong; C. Zhang; R. Liu; C. Luo; Y. Wu; L. Zhang Evaluating the contribution of Yr genes to stripe rust resistance breeding through marker-assisted detection in wheat, Euphytica., Volume 213 (2017), p. 50

[37] M.G. Murray; W.F. Thompson Rapid isolation of high molecular weight plant, Nucleic Acids Res., Volume 8 (1980), pp. 4321-4325

[38] M.A. Saghai-Maroof; K. Soliman; R.A. Jorgensen; R.W. Allard Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics, Proc. Natl. Acad. Sci. USA, Volume 81 (1984), pp. 8014-8018

[39] G.W. Xu; C.W. Magill; K.F. Schertz; G.E. Hart An RFLP linkage map of Sorghum bicolor (L.) Moench, Theor. Appl. Genet., Volume 89 (1994), pp. 139-145

[40] R.F. Peterson; A.B. Campbell; A.E. Hannah A diagrammatic scale for estimating rust severity on leaves and stems of cereals, Can. J. Genet. Cytol., Volume 26 (1948), pp. 496-500

[41] Z.Q. Li; S.M. Zeng Wheat rusts in China, China Agricultural, Beijing, 2002

[42] E.C. Stakman; D.M. Stewart; W.Q. Loegering Identification of physiologic races of Puccinia graminis var. tritici, US Department Agriculture, Volume 617 (1962), p. 53 p

[43] L. Feng; L. Shichang; L. Zhang; M. Qing; Z. Qiang; Nan Li. SSR marker of wheat stripe rust resistance gene Yr2, J. Trit. Crops., Volume 25 (2005), pp. 17-19

[44] R.C.F. Macer The formal and monosomic genetic analysis of stripe rust (Puccinia striiformis) resistance in wheat. In. Proc 2nd Int Wheat Genet Symp, Lund, Hereditas Suppl., Volume 2 (1963), pp. 127-142

[45] C.N. Law, Plant Breeding Institute, Cambridge, Annual Report (1976), pp. 108-109

[46] Q. Sun; Y. Wei; Z. Ni; C. Xie; T. Yang Microsatellite marker for yellow rust resistance gene Yr5 in wheat introgressed from spelt wheat, Plant Breed., Volume 121 (2002), pp. 539-541

[47] P.H. Smith; J. Hadfield; N.J. Hart; R.M.D. Koebner; L.A. Boyd STS markers for the wheat yellow rust resistance gene Yr5 suggest a NBS–LRR-type resistance gene cluster, Genome., Volume 50 (2007), pp. 259-326

[48] L.R. Murphy; D. Santra; K. Kidwell; G.P. Yan; X.M. Chen; K. Garland-Campbell A Linkage maps of wheat stripe rust resistance genes Yr5 and Yr15 for use in marker-assisted selection, Crop Sci., Volume 49 (2009), pp. 1786-1790

[49] G.R.D. McGrann; P.H. Smith; C. Burt; G.R. Mateos; T.N. Chama; R. MacCormack; E. Wessels; G. Agenbag; L.A. Boyd Genomic and genetic analysis of the wheat race-specific yellow rust resistance gene Yr5, J. Plant Sci. Mol. Breed., Volume 3 (2014), p. 2

[50] R.C.F. Macer The resistance of cereals to yellow rust and its exploitation by breeding, Proc. R. Soc. London Ser. B. Biol. Sci., Volume 181 (1972), pp. 281-301

[51] Z.J. Yao; R.M. Lin; S.C. Xu et al. Inheritance analysis of wheat yellow rust resistance of the international differential host Lee to Chinese isolates CY23, Plant Prot., Volume 32 (2006), pp. 41-43

[52] P. Zhang; R.A. McIntosh; S. Hoxha; C. Dong Wheat stripe rust resistance genes Yr5 and Yr7 are allelic, Theor. Appl. Genet., Volume 120 (2009), pp. 25-29

[53] SUSDA, 2017 https://www.ars.usda.gov/

[54] E. Cabuk; Y. Aydin; A.A. Uncuoglu Assessing wheat (Triticum aestivum) genotypes for “Yr” resistance genes using conserved regions and simple-sequence motifs, Genet. Mol. Res., Volume 10 (2011), pp. 3463-3471

[55] R. Mago; H. Miah; G.J. Lawrence; C.R. Wellings; W. Spielmeyer; H.S. Bariana; R.A. McIntosh; A.J. Pryor; J.G. Ellis High resolution mapping and mutation analysis separate the rust resistance genes Sr31, Lr26 and Yr9 on the short arm of rye chromosome 1, Theor. Appl. Genet., Volume 112 (2005), pp. 41-50

[56] R.J. Metzger; B.A. Silbaugh Inheritance of resistance to stripe rust and its association with brown glume color in Triticum aestivum L.PI178383, Crop. Sci., Volume 10 (1970) (567-568.55)

[57] P. Payne; L. Holt; R. Johnson; J. Snape Linkage mapping of four gene loci, Glu-B1, Gli-B1, Rg1 and Yr10 on chromosome 1B of bread wheat, Genet. Agraria, Volume 40 (1986), pp. 231-242

[58] S. Sharma; P.R. Bhat; B. Ehdaie; T.J. Close; A.J. Lukaszewski; J.G. Waines Integrated genetic map and genetic analysis of a region associated with root traits on the short arm of rye chromosome 1 in bread wheat, Theor. Appl. Genet., Volume 119 (2009), pp. 783-793

[59] S. Mukhtar; M.A. Khan; B.A. Paddar; A. Azra; G. Zaffar; S.A. Mir; S. Naseer; M.A. Bhat; Kamaluddin Molecular characterization of wheat germplasm for stripe rust resistance genes (Yr5Yr10, Yr15 & Yr18) and identification of candidate lines for stripe rust breeding in Kashmir, Indian J. Biotechnol., Volume 14 (2015), pp. 241-248

[60] H.S. Bariana; G.N. Brown; N.U. Ahmed; S. Khatkar; R.L. Conner; C.R. Wellings et al. Characterization of Triticum vavilovii derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection, Theor. Appl. Genet., Volume 104 (2002), pp. 315-320

[61] R.A. McIntosh; J. Silk; T.T. The Cytogenetic studies in wheat XVII, Monosomic analysis and linkage relationships of gene Yr15 for resistance to stripe rust, Euphytica., Volume 89 (1996), pp. 395-399

[62] M. Sivasamy; P. Jayaprakash; V.K. Vikas; K. Jagdish; G.P. Vinod Singh; R. Yadav; R.K. Sharma; S. Kumar; A. Mahendru; J.B. Sharma; X. Prabhu; J.B. Nallathambi; P. Maheswari; C.U. Kumari; A.N. Senthil; N.P. Veerabadhiran, Nilgiri wheat news (2014), p. 6

[63] G.M. Agenbag; Z.A. Pretorius; L.A. Boyd; C.M. Bender; R. Prins Identification of adult-plant resistance to stripe rust in the wheat cultivar Cappelle-Desprez, Theor. Appl. Genet., Volume 125 (2012), pp. 109-120

[64] N. Maia Obtention des blés tendres resistants au pietin-verse par croisements interspecifiques blés X Aegilops, C. R. Séances Acad. Agric. Fr., Volume 53 (1967), pp. 149-154

[65] E.S. Lagudah; H. McFadden; R.P. Singh; J. Huerta-Espino; H.S. Bariana; W. Spielmeyer Molecular genetic characterization of the Lr34/Yr18 slow rusting resistance gene region in wheat, Theor. Appl. Genet., Volume 114 (2006), pp. 21-30

[66] J.X. Ma; R.H. Zhou; Y.S. Dong; L.F. Wang; X.M. Wang; J.Z. Jia Molecular mapping and detection of the yellow rust resistance gene Yr26 in wheat transferred from Triticum turgidum L. using microsatellite markers, Euphytica., Volume 120 (2001), pp. 219-226

[67] G.Q. Li; Z.F. Li; W.Y. Yang; Y. Zhang; Z.H. He; S.C. Xu; R.P. Singh; T.T. Qu; X.C. Xia Molecular mapping of stripe rust resistance gene YrCH42 in Chinese wheat cultivar Chuanmai 42 and its allelism with Yr24 and Yr26, Theor. Appl. Genet., Volume 112 (2006), pp. 1434-1440

[68] C. Wang; Y. Zhang; D. Han; Z. Kang; G. Li; A. Cao et al. SSR and STS markers for wheat stripe rust resistance gene Yr26, Euphytica., Volume 159 (2008), pp. 359-366

[69] W. Wen; G. Li; Z. He; W. Yang; M. Xu; X. Xia Development of an STS marker tightly linked to Yr26 against wheat stripe rust using the resistance gene-analog polymorphism (RGAP) technique, Mol. Breed., Volume 22 (2008), pp. 507-515

[70] D.B. McDonald; R.A. McIntosh; C.R. Wellings; R.P. Singh; J.C. Nelson Cytogenetical Studies in Wheat XIX. Location and linkage studies on gene Yr27 for resistance to stripe (yellow) rust, Euphytica., Volume 136 (2004), pp. 239-248

[71] G. Mustafa; M.M. Alam; S.U. Khan; M. Naveed; A.S. Mumtaz Leaf rust resistance in semi dwarf wheat cultivars: a conspectus of post green revolution period in Pakistan, Pak. J. Bot., Volume 45 (2013), pp. 415-422

[72] A.P. Roelfs; W.R. Bushnell The Cereal Rusts II: Disease, Distribution, Epidemiology, and Control, Academic Press, New York, 1985

[73] R.A. McIntosh; C.R. Wellings; R.F. Park, Australia: CSIRO Publishing, Melbourne (1995), p. 200

[74] M. William; R.P. Singh; J. Huerta-Espino; S.O. Islas; D. Hoisington Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene Yr29 in wheat, Phytopathology, Volume 93 (2003), pp. 153-159

[75] G.M. Rosewarne; R.P. Singh; J. Huerta-Espino; H.M. William; S. Bouchet; S. Cloutier et al. Leaf tip necrosis, molecular markers and β1-proteasome subunits associated with the slow rusting resistance genes Lr46/Yr29, Theor. Appl. Genet., Volume 112 (2006), pp. 500-508

[76] S. Singh; J.S. Sidhu; N. Huang; Y. Vikal; Z. Li; D.S. Brar; H.S. Dhaliwal; G.S. Khush Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106, Theor. Appl. Genet., Volume 102 (2001), pp. 1011-1015

[77] R.A. McIntosh; Y. Yamazaki; J. Dubcovsky; J. Rogers; C. Morris; R. Appels; X.C. Xia In. Proceedings of the 12th International Wheat Genetics Symposium, Yokohama, Japan (2013)

[78] R.P. Singh; J. Huerta-Espino; W. Pfeiffer; P. Figueroa-Lopez Occurrence and impact of a new leaf rust race on durum wheat in northwestern Mexico from 2001 to 2003, Plant Dis., Volume 88 (2004), pp. 703-708

[79] R.W. Stubbs Stripe rust (A.P. Roelfs; W.R. Bushnell, eds.), The cereal rusts, Diseases, distribution, epidemiology and control,, vol. 2, Academic Press, Orlando, FL? USA, 1985, pp. 61-101

[80] L. Eriksen; F. Afshari; M.J. Christiansen; R.A. McIntosh; A. Jahoor; C.R. Wellings Yr32 for resistance to stripe rust present in the wheat cultivar Carstens V, Theor. Appl. Genet., Volume 108 (2004), pp. 567-575

[81] G.F. Marais; B. McCallum; J.E. Snyman; Z.A. Pretorius; A.S. Marais Leaf rust and stripe rust resistance genes Lr54 and Yr37 transferred to wheat from Aegilops kotschyi, Plant Breed., Volume 124 (2005), pp. 538-541

[82] C. Uauy; J.C. Brevis; X. Chen; I. Khan; L. Jackson; O. Chicaiza et al. High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein content locus gpc-b1, Theor. Appl. Genet., Volume 112 (2005), pp. 97-105

[83] D. Fu; C. Uauy; A. Distelfeld; A. Blechl; L. Epstein; X. Chen; H. Sela; T. Fahima; J. Dubcovsky A kinase-START gene confers temperature-dependent resistance to wheat stripe rust, Science., Volume 323 (2009), pp. 1357-1360

[84] V. Kuraparthy; S. Sood; D.R. See; B.S. Gill Development of a PCR assay and marker-assisted transfer of leaf rust and stripe rust resistance genes Lr57 and Yr40 into hard red winter wheats, Crop. Sci., Volume 49 (2009), pp. 120-126

[85] S.A. Herrera-Foessel; R.P. Singh; M. Lillemo; J. Huerta-Espino; S. Bhavani; S. Singh; C. Lan; V. Calvo-Salazar; E.S. Lagudah Lr67/Yr46 confers adult-plant resistance to stem rust and powdery mildew in wheat, Theor. Appl. Genet., Volume 127 (2014), pp. 781-789

[86] U.K. Bansal; M.J. Hayden; M.B. Gill; H.S. Bariana Chromosomal location of an uncharacterised stripe rust resistance gene in wheat, Euphytica., Volume 171 (2010), pp. 121-127

[87] I. Lowe; L. Jankuloski; S. Chao; X. Chen; D. See; J. Dubcovsky Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat, Theor. Appl. Genet., Volume 123 (2011), pp. 143-157

[88] M. William; R.P. Singh; J. Huerta-Espino; S.O. Islas; D. Hoisington Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene Yr29 in wheat, Phytopathology, Volume 93 (2003), pp. 153-159

[89] K.V. Singh; R.C. Mathuria; G.P. Singh; P.K. Singh; S. Singh; R. Gogoi; R. Aggarwal Characterization of yellow rust resistance genes by using gene postulation and assessment of adult-plant resistance in some Indian wheat genotypes, Res. Crops., Volume 16 (2015), pp. 741-750

[90] A. Haque; T. Shaheen; T. Gulzar; M.U. Rahman; F. Jalal; S. Sattar; B. Ehsan; Z. Iqbal; M. Younas Study of rust resistance genes in wheat germplasm with DNA markers, Bioinformation., Volume 10 (2014), pp. 371-377

[91] C.L. Yuan; H. Jiang; H.G. Wang; K. Li; H. Tang; X.B. Li; D.L. Fu Distribution, frequency and variation of stripe rust resistance loci Yr10, Lr34/Yr18 and Yr36 in Chinese wheat cultivars, J. Genet. Genom., Volume 39 (2012), pp. 587-592

[92] H. Bux; M. Ashraf; F. Hussain; A.U.R. Rattu; M. Fayyaz Characterization of wheat germplasm for stripe rust (Puccinia striiformis f. sp. tritici) resistance, Aust. J. Crop Sci., Volume 6 (2012), pp. 116-120

[93] F. Afshari Prevalent pathotypes of Puccinia striiformis f. sp. tritici, Iran, J. Agric. Sci. Technol., Volume 10 (2008), pp. 67-78

[94] A. Zeybek; F. Yigit Determination of virulence genes frequencies in wheat stripe rust (Puccinia striiformis f. sp. tritici) populations during natural epidemics in the regions of Southern Aegean and Western Mediterranean in Turkey, Pak. J. Biol. Sci., Volume 7 (2004), pp. 1967-1971

[95] R. Chatrath; B. Mishra; G. Ortiz, Ferrara; S.K. Singh; A.K. Joshi Challenges to wheat production in South Asia, Euphytica, Volume 157 (2007), pp. 447-456

[96] E. Yaniv; D. Raats; Y. Ronin; A.B. Korol; A. Grama; H. Bariana; J. Dubcovsky; A.H. Schulman Evaluation of marker-assisted selection for the stripe rust resistance gene Yr15, introgressed from wild emmer wheat, Mol. Breed., Volume 35 (2015), pp. 43-49

[97] M. Talha; Swati; Harsha; J.P. Jaiswal Marker assisted detection of underutilized potential yr genes in elite wheat breeding lines, SABRAO J. Breed Genet., Volume 48 (2016) no. 3, pp. 309-317

[98] L. Wu; X.C. Xia; G.M. Rosewarne; H.Z. Zhu; S.Z. Li; Z.Y. Zhang; Z.H. He Stripe rust resistance gene Yr18 and its suppressor gene in Chinese wheat landraces, Plant Breed., Volume 134 (2015), pp. 634-640

[99] W. Yang; F. Yang; D. Liang; Z. He; X. Shang; X. Xia Molecular characterization of slow-rusting genes Lr34/Yr18 in Chinese wheat cultivars, Acta Agron. Sin., Volume 34 (2008), pp. 1109-1113

[100] K. Alma; Y. Gulzat; M. Alex; O. Francis The Screening of Wheat Germplasm for Resistance to Stripe and Leaf Rust in Kazakhstan Using Molecular Markers, J. Life Sci., Volume 6 (2012), pp. 353-362

[101] B. Yang; J. Wanquan; C. Wang; F. Xue; M. Ali; Y. Wang; H. Zhang; X. Liu Chromosome location and ssr markers of a stripe rust resistance Gene from wheat (triticum aestivum) line n9738, Pak. J. Bot., Volume 45 (2013) no. 3, pp. 719-724

[102] A. Bipinraj; B. Honrao; M. Prashar; S. Bhardwaj; S. Rao; S. Tamhankar Validation and identification of molecular markers linked to the leaf rust resistance gene Lr28 in 216 wheat, J. Appl. Genet., Volume 52 (2011), pp. 171-175

[103] C.A. McCartney; A.L. Brûlé-Babel; L. Lamari; D.J. Somers Chromosomal location of a race-specific resistance gene to Mycosphaerella graminicola in the spring wheat ST6, Theor. Appl. Genet., Volume 107 (2003), pp. 1181-1186

[104] M. Wang; X. Chen Stripe rust resistance (X. Chen; Z. Kang, eds.), Stripe Rust, Springer, 2017, pp. 353-558 | DOI

[105] S. Herrera-Foessel; E. Lagudah; J. Huerta-Espino; M. Hayden; H. Bariana; D. Singh; R. Singh New slow-rusting leaf rust and stripe rust resistance genes Lr67 and Yr46 in wheat are pleiotropic or closely linked, Theor. Appl. Genet., Volume 122 (2011), pp. 239-249

[106] J.W. Moore; S. Herrera-Foessel; C. Lan; W. Schnippenkoetter; M. Ayliffe; J. Huerta-Espino; M. Lillemo; L. Viccars; R. Milne; S. Periyannan; X. Kong; W. Spielmeyer; M. Talbot; H. Bariana; J.W. Patrick; P. Dodds; R. Singh; E. Lagudah A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat, Nat. Genet., Volume 47 (2015), pp. 1494-1498

[107] M. Hussain; M.A. Khan; M. Hussain; N. Javed; I. Khaliq Application of phenotypic and molecular markers to combine genes for durable resistance against rust virulences and high yield potential in wheat, Int. J. Agric. Biol., Volume 17 (2015), pp. 421-430

[108] N. Asghar; Inamullah; A. Hayat; S. Rehman; Z. Khan; A. Khan; Ibrarullah Molecular analysis of combined leaf and stripe rust resistant genes in selected wheat germplasm, Imp. J. Interdiscip. Res., Volume 2 (2016), p. 10

[109] A. Madenova; G. Kokhmetova; L. Kampitova; Purnhauser; M. Atishova Identification of the Carriers of Genes for Resistance to Wheat Leaf Rust Using Molecular Markers, Biosci. Biotechnol. Res. Asia, Volume 12 (2015) no. 2, pp. 1683-1690

[110] R. Singh; J. Huerta-Espino; S. Bhavani; S. Herrera-Foessel; D. Singh; P. Singh; G. Velu; R. Mason; Y. Jin; P. Njau; J. Crossa Race non-specific resistance to rust diseases in CIMMYT spring wheats, Euphytica., Volume 179 (2011), pp. 175-186

[111] S. Begum; M. Iqbal; I. Ahmed; M. Fayyaz; A. Shahzad; G.M. Ali Allelic variation at loci controlling stripe rust resistance in spring wheat, J. Genet., Volume 93 (2014), pp. 579-586

[112] O. Robert; F. Dedryver; M. Leconte; B. Rolland; C. Vallavieille-Pope Combination of resistance tests and molecular tests to postulate the yellow rust resistance gene Yr17 in bread wheat lines, Plant Breed., Volume 119 (2000), pp. 467-472

[113] L. Feng; L. Shichang; L. Zhang; M. Qing; Z. Qiang; Li.; Nan. SSR marker of wheat stripe rust resistance gene Yr2, J Trit Crops., Volume 25 (2005), pp. 17-19

[114] P. Revathi; S.M.S. Tomar; N.K. Singh Marker assisted gene pyramiding of leaf rust resistance genes Lr24, Lr28 along with stripe rust resistance gene Yr15 in wheat (Triticum aestivum L.), Indian J. Genet, Volume 70 (2010), pp. 349-354

[115] F. Lin; X.M. Chen Quantitative trait loci for non-race-specific, high-temperature adult-plant resistance to stripe rust in wheat cultivar Express, Theor Appl Genet., Volume 118 (2009), pp. 631-642

[116] H.T. Guan; Y.H. Guo; Y.B. Wang; T.G. Liu; R.M. Lin; S.C. Xu Microsatellite marker of the resistance gene YrSpP to wheat stripe rust, Sci Agric Sin., Volume 38 (2005), pp. 1547-1577

[117] P.G. Luo; X.Y. Hu; Z.L. Ren; H.Y. Zhang; K. Shu; Z.J. Yang Allelic analysis of stripe rust resistance genes on wheat chromosome 2BS, Genome., Volume 51 (2008), pp. 922-927

[118] F. Lin; X.M. Chen Molecular mapping of genes for race-specific overall resistance to stripe rust in wheat cultivar Express, Theor Appl Genet., Volume 116 (2008), pp. 797-806

[119] R. Seyfarth Development of Molecular Markers for the Adult Plant Leaf Rust Resistance Genes Lr13 and Lr35 in Wheat (Triticum aestivum L.). Ph.D. thesis, Swiss Federal Institute of Technology, Zürich, 2000

[120] M. Lillemo; B. Asalf; R.P. Singh; J. Huerta-Espino; X.M. Chen; Z.H. He; A. Bjornstad The adult plant rust resistance loci Lr34/Yr18 and Lr46/Yr29 are important determinants of partial resistance to powdery mildew in bread wheat line Saar, Theor. Appl. Genet., Volume 116 (2008), pp. 1155-1166

[121] J. Liu; L. Liu; N. Hou; A. Zhang; C. Liu Genetic diversity of wheat gene pool of recurrent selection assessed by microsatellite markers and morphological traits, Euphytica, Volume 155 (2007), pp. 249-258

[122] W. Spielmeyer; P.J. Sharp; E.S. Lagudah Identification and validation of markers linked to broad-spectrum stem rust resistance gene Sr2 in wheat (Triticum aestivum L.), Crop Sci., Volume 43 (2003), pp. 333-336

[123] R. Mago; H. Simkova; G. Brown-Guedira; S. Dreisigacker; J. Breen; Y. Jin; R. Singh; R. Appels; E.S. Lagudah; J. Ellis; J. Dolezel; W. Spielmeyer An accurate DNA marker assay for stem rust resistance gene Sr2 in wheat, Theor Appl Genet., Volume 122 (2011), pp. 735-744

[124] Q. Li; X.M. Chen; M.N. Wang; J.X. Jing Yr45, a new wheat gene for stripe rust resistance on the long arm of chromosome 3D, Theor Appl Genet, Volume 122 (2011), pp. 189-197

[125] C.W. Hiebert; J.B. Thomas; B.D. McCallum; D.G. Humphreys; R.M. DePauw; M.J. Hayden; R. Mago; W. Schnippenkoetter; W. Spielmeyer An introgression on wheat chromosome 4DL in RL6077 (Thatcher*6/PI 250413) confers adult plant resistance to stripe rust and leaf rust (Lr67), Theor Appl Genet. (2010) | DOI

[126] I. Lowe; L. Jankuloski; S. Chao et al. Mapping and validation of QTL which confer partial resistance to broadly virulent post 2000 North American races of stripe rust in hexaploid wheat, Theor. Appl. Genet., Volume 123 (2011), pp. 143-157

[127] Z.J. Cao; Z.Y. Deng; M.N. Wang; X.P. Wang; J.X. Jing; X.Q. Zhang; H.S. Shang; Z.Q. Li Inheritance and molecular mapping of an alien stripe-rust resistance gene from a wheat-Psathyrostachys huashanica translocation line, Plant Sci., Volume 174 (2008), pp. 544-549

[128] D.J. Somers; P. Isaac; K. Edwards A high-density microsatellite consensus map for bread wheat (Triticum aestivum L.), Theor. Appl. Genet., Volume 109 (2004), pp. 1105-1114

[129] E.S. Lagudah; S.G. Krattinger; S. Herrera-Foessel; R.P. Singh; J. HuertaEspino; W. Spielmeyer; G. Brown-Guedira; L.L. Selter; B. Keller Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens, Theor. Appl. Genet., Volume 119 (2009), pp. 889-898

[130] H.S. Bariana; U.K. Bansal; A. Schmidt; A. Lehmensiek; J. Kaur; H. Miah; N. Howes; C.L. McIntyre Molecular mapping of adult-plant stripe rust resistance in wheat and identification of pyramided QTL genotypes, Euphytica., Volume 176 (2010), pp. 251-260

[131] C. Pooja; V. Prince Genetic diversity of bread wheat genotypes (Triticum aestivum L.) revealed by microsatellite SSR markers for leaf and stripe rust resistance, J. Pharma Phy., Volume SP1 (2019), pp. 86-93

[132] N.A. Dadkhodaie; H. Karaoglou; C.R. Wellings; R.F. Park Mapping genes Lr53 and Yr35 on the short arm of chromosome 6B of common wheat with microsatellite markers and studies of their association with Lr36, Theor. Appl. Genet., Volume 122 (2011), pp. 479-487

[133] X.L. Zhou; D.J. Han; H.L. Gou; Q.L. Wang; Q.D. Zeng; F.P. Yuan; G.M. Zhan; L.L. Huang; Z.S. Kang Molecular mapping of a stripe rust resistance gene in wheat cultivar Wuhan 2, Euphytica, Volume 196 (2014), pp. 251-259


Comments - Policy