Outline
Comptes Rendus

Physiology/Physiologie
StAR protein and steroidogenic enzyme expressions in the rat Harderian gland
Comptes Rendus. Biologies, Volume 341 (2018) no. 3, pp. 160-166

Abstract

The Harderian gland (HG) of the rat (Rattus norvegicus) secretes copious amounts of lipids, such as cholesterol. Here we report a study of the expressions of the StAR protein and key steroidogenic enzymes in the HG of male and female rats. The objective of the present investigation was to ascertain (a) whether the rat HG is involved in steroid production starting with cholesterol, and (b) whether the pattern of gene and protein expressions together with the enzymatic activities display sexual dimorphism. The results demonstrate, for the first time, the expression of StAR gene and protein, and Cyp11a1, Hsd3b1, Hsd17b3, Srd5a1, Srd5a2 and Cyp19a1 genes in the rat HG. StAR mRNA and protein expressions were much greater in males than in females. Immunohistochemical analysis demonstrated a non-homogeneous StAR distribution among glandular cells. Hsd17b3 and Cyp19a1 mRNA levels were higher in males than in females, whereas Srd5a1 mRNA levels were higher in females than in males. No significant differences were observed in mRNA levels of Cyp11a1, Hsd3b1 and Srd5a2 between sexes. Furthermore, the in vitro experiments demonstrated a higher 5α-reductase activity in the female as compared to the male HG vice versa a higher P450 aro activity in males as compared to females. These results suggest that the Harderian gland can be classified as a steroidogenic tissue because it synthesizes cholesterol, expresses StAR and steroidogenic enzymes involved in both androgen and estrogen synthesis. The dimorphic expression and activity of the steroidogenic enzymes may suggest sex-specific hormonal effects into the HG physiology.

Metadata
Received:
Accepted:
Published online:
DOI: 10.1016/j.crvi.2018.02.001
Keywords: Harderian gland, Steroidogenesis, StAR protein, 5α-Reductase, Cytochrome p450 aromatase

Sara Falvo  1 ; Gabriella Chieffi Baccaria  1 ; Giuseppe Spaziano  2 ; Luigi Rosati  3 ; Massimo Venditti  2 ; Maria Maddalena Di Fiore  1 ; Alessandra Santillo  1

1 Department of Environmental, Biological, and Pharmaceutical Sciences & Technologies, University of Campania “L. Vanvitelli”, Caserta, Italy
2 Department of Experimental Medicine, School of Medicine, University of Campania “L. Vanvitelli”, Napoli, Italy
3 Department of Biology, Federico II Naples University, Napoli, Italy
Sara Falvo; Gabriella Chieffi Baccaria; Giuseppe Spaziano; Luigi Rosati; Massimo Venditti; Maria Maddalena Di Fiore; Alessandra Santillo. StAR protein and steroidogenic enzyme expressions in the rat Harderian gland. Comptes Rendus. Biologies, Volume 341 (2018) no. 3, pp. 160-166. doi: 10.1016/j.crvi.2018.02.001
@article{CRBIOL_2018__341_3_160_0,
     author = {Sara Falvo and Gabriella Chieffi Baccaria and Giuseppe Spaziano and Luigi Rosati and Massimo Venditti and Maria Maddalena Di Fiore and Alessandra Santillo},
     title = {StAR protein and steroidogenic enzyme expressions in the rat {Harderian} gland},
     journal = {Comptes Rendus. Biologies},
     pages = {160--166},
     year = {2018},
     publisher = {Elsevier},
     volume = {341},
     number = {3},
     doi = {10.1016/j.crvi.2018.02.001},
     language = {en},
}
TY  - JOUR
AU  - Sara Falvo
AU  - Gabriella Chieffi Baccaria
AU  - Giuseppe Spaziano
AU  - Luigi Rosati
AU  - Massimo Venditti
AU  - Maria Maddalena Di Fiore
AU  - Alessandra Santillo
TI  - StAR protein and steroidogenic enzyme expressions in the rat Harderian gland
JO  - Comptes Rendus. Biologies
PY  - 2018
SP  - 160
EP  - 166
VL  - 341
IS  - 3
PB  - Elsevier
DO  - 10.1016/j.crvi.2018.02.001
LA  - en
ID  - CRBIOL_2018__341_3_160_0
ER  - 
%0 Journal Article
%A Sara Falvo
%A Gabriella Chieffi Baccaria
%A Giuseppe Spaziano
%A Luigi Rosati
%A Massimo Venditti
%A Maria Maddalena Di Fiore
%A Alessandra Santillo
%T StAR protein and steroidogenic enzyme expressions in the rat Harderian gland
%J Comptes Rendus. Biologies
%D 2018
%P 160-166
%V 341
%N 3
%I Elsevier
%R 10.1016/j.crvi.2018.02.001
%G en
%F CRBIOL_2018__341_3_160_0

Original version of the full text

The full text below may contain a few conversion errors compared to the version of record of the published article.

1 Introduction

The Harderian gland (HG) is an orbital gland found in the majority of land vertebrates [1–4]. Although the function of this gland is still unclear, its size and widespread occurrence among vertebrates suggest that it has potentially important more roles.

One of the main characteristics of this gland is the extreme variety, not only of its morphology at the ultrastructural level, but also its biochemical properties being the secretory material specific for each species, genus, or order. This most likely reflects a versatility of functions related to different adaptations of the species considered.

The rat HG produces large amounts of lipids and porphyrins, which are secreted into the conjunctival sac. The lipids are represented by fatty acids with chain lengths from 12 to 22 carbon atoms and fatty alcohols derived from wax esters, and cholesterol [5–7]. The function of the lipid secretions is not well established; however, roles in the protection of the cornea and lubrication of the nictitating membrane have been suggested [5–7]. Moreover, other functions have been hypothesized, such as an involvement in thermoregulation [8,9], in a bactericidal effect, and as a solvent for bioactive substances as well as pheromones [6,10,11]. The production of porphyrins in the HG suggests that these molecules are phototransducers with an ability to absorb UV light [12,13]. Finally, due to the production of melatonin, an involvement of the HG in the retinal-pineal axis has been proposed [14–18].

Furthermore, the complexity of this gland is evident in its control by many exogenous (light and temperature) and endogenous factors (such as steroid hormones). Androgen and estrogen receptors occur in the HGs of rat and golden hamster [19,20]. The androgen receptor in the hamster HG binds 5α-dihydrotestosterone with a higher affinity than testosterone [19,21], suggesting that 5α-dihydrotestosterone has a greater effect on the secretory activity of the HG and on sexual dimorphism than testosterone [22,23]. Further, a correlation between estrogens and HG porphyrin content has been documented in rodents [24].

Although the steroid hormones are different, they are synthesized from a common precursor substrate, which is cholesterol. Steroidogenesis thus begins with the transport of cholesterol across the mitochondrial membrane and is mediated by the Steroidogenic Acute Regulatory (StAR) protein, considered to be the rate-limiting step in steroid hormone biosynthesis [25,26]. Subsequently, cholesterol is converted to pregnenolone by cytochrome P450 side chain cleavage (P450scc, the product of Cyp11a1 gene); pregnenolone diffuses into the cytosol and is converted in the smooth endoplasmic reticulum to progesterone and then androstenedione by 3β-hydroxysteroid dehydrogenase (3β-HSD, the product of Hsd3b1gene). Then, 17β-hydroxysteroid dehydrogenase (17β-HSD, the product of the Hsd17b3 gene) catalyzes the conversion of androstenedione to testosterone, which is the main final product of the steroidogenic process. Testosterone can thus be converted into either a more potent androgen, the 5α-dihydrotestosterone by 5α-reductase (5α-Red, the product of the Srd5a gene) or into 17β-estradiol by cytochrome P450 aromatase (P450 aro, the product of the Cyp19a1gene). Steroidogenic activity in the HG has not been documented to date, although studies have demonstrated the occurrence of P450scc and 5α-Red expressions in the hamster HG [27,28].

In this study, we analyze the expressions of the StAR protein and key steroidogenic enzymes in the HGs of male and female Rattus norvegicus. The objective of the present investigation was to ascertain (a) whether the rat HG is involved in steroid production starting with cholesterol, and (b) whether the pattern of gene and protein expressions displays sexual dimorphism.

2 Materials and methods

2.1 Animals

Male and female Wistar rats, Rattus norvegicus, weighing 300–350 g, were kept under regulated conditions of temperature (24 ± 2 °C) and light (12 h light/12 h dark cycles). The females were randomly selected during the reproductive cycle. They received commercial food pellets and water ad libitum. Rats were first anesthetized by an i.p. injection of chloral hydrate (40 mg/g body mass), and then decapitated. The HGs as well as testes and ovaries (positive controls) were dissected out and rapidly immersed in liquid nitrogen for biochemical and molecular determinations, as described below. Pieces of glands were quickly immersed in fixative for light or electron microscopy. The experimental protocols below described, as well as the housing conditions, was in accordance with the Italian guidelines (D.Lvo 116/92) and authorized by the local Animal Care Committee (ASL 44, Prot. Vet. 22/95). All efforts were made to reduce animal suffering and the number of animals.

2.2 RNA isolation and RT-PCR

Total RNA was extracted from the rat HG and gonads (100 mg from each animal), using TRIzol standard protocol (Invitrogen Life Technologies) and then treated for 30 min at 37 °C with DNase I (10 U/sample) (Amersham Bioscience) to eliminate any contaminations of genomic DNA. Total RNA purity and integrity were determined by spectrophotometry at 260/280 nm and electrophoresis on a denaturizing formaldehyde agarose gel [29]. One microgram of total RNA was reverse-transcribed using the SuperScriptTM First-Strand Synthesis System kit (Invitrogen Life Technologies). Specific primer sets were designed for RT-PCR using Primer 3 (http://frodo.wi.mit.edu/primer3). The sequences of the primers used were reported in Table 1.

Table 1

Primers for RT-PCR.

Table 1
Gene Forward primer (5′ to 3′) Reverse primer (5′ to 3′) GeneBank Accession No.
Star agctccaaatgccactacct tggccttttacagaggagca AF044081.1
Cypllal accccatctctgtgaccttg tcgacccatggcatagctag J05156.1
Hsd3bl tttgtgggccagaggatcat gtcaccttggcctttgtctg NM_00100719.3
Hsdl7b3 cacatggaatcaaggcggag ctatacagaggccagggacg NM_054007
Srd5al cacctttgtcttggccttcc tcaggaaacagggatgggtc NM_017070.3
Srd5a2 tcacaagagggaggcctttc tctgcgagtaaaccaggta NM_022711.4
Cypl9al gctcccaggagtgtagcttg ccacaccacacacagagtcc NM_017085.2
β-Actin agccatgtacgta gccatcc ccctcatagatgggcacag NM 031144.3

As internal control, the same cDNAs were amplified using β-actin oligonucleotide primers (Table 1). For the actual analysis, samples were heated for 3 min at 94 °C. Then 35 cycles were carried out, each consisting of 45 s at 94 °C, 45 s at 55–58 °C (55 °C for Hsd3b1; 56 °C for Cyp11a1; 57 °C for Star, Hsd17b1, Srd5a1 and Srd5a2; 58 °C for Cyp19a1), and 1 min at 72 °C. This was followed by a final 7-min extension at 72 °C. Finally, the PCR reaction products, separated on a 1.5% agarose gel containing ethidium bromide, were rapidly visualized. The amount of mRNA levels was quantified by ImageJ software.

2.3 Preparation of mitochondrial fraction and Western blot analysis

Mitochondria were isolated after homogenization of HGs, testes and ovaries (300 mg from each animal) in an isolation medium consisting of 220 mM mannitol, 70 mM sucrose, 20 mM Tris–HCl, 1 mM EDTA, 5 mM EGTA, and 5 mM MgCl2, pH 7.4, supplemented with the following protease inhibitors: 1 mM benzamidine, 4 mg/ml aprotinin, 1 mg/ml pepstatin, 2 mg/ml leupeptin, 5 mg/ml bestatin, 50 mg/ml N-tosyl-l-phenylalaninechloromethyl ketone, and 0.1 mM phenylmethylsulfonylfluoride. After homogenization, the samples were centrifuged at 700 g for 10 min. The supernatant was collected and transferred into new tubes for subsequent centrifugation at 10,000 g for 10 min. The obtained mitochondrial pellet was washed twice, then resuspended in a minimal volume of isolation medium, and kept on ice. Protein concentrations of mitochondrial fraction were estimated using a modified Bradford assay (Bio-Rad, Melville, NY, USA) [30–32]. The protein extracts were boiled in Laemmli sample buffer, separated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred onto a nitrocellulose membrane. The complete transfer was assessed using prestained protein standards (Bio-Rad, Melville, NY). Membranes were first treated for 1 h with a blocking solution (5% non-fat powdered milk in 25 mMTris, pH 7.4; 200 mMNaCl; 0.5% TritonX-100, TBS/Tween) and then incubated overnight at 4 °C with polyclonal rabbit anti-StAR antibody (diluted 1:1000) (#EAP0193, Elabscience) or with polyclonal mouse anti-β-actin antibody (#sc-81178; Santa Cruz Biotechnology) (diluted 1:2000). After washing with TBS/Tween, the membranes were incubated with the horseradish-peroxidase-conjugated secondary antibody for 1 h at room temperature. The reactions were detected using an enhanced chemiluminescence (ECL) system (Amersham Bioscience, UK). Bands were quantified by ImageJ software.

2.4 Ultrastructure

For electron microscopy, pieces of HG (3 mm3) were promptly immersed and left for 3 h in Karnovsky's fixative in cachodylate buffer (pH 7.4), then postfixed for 2 h in cachodylate buffer containing 1% osmium tetroxide. The samples were dehydrated through a graded ethanol series, and finally embedded in Epon 812 [33,34]. Ultrathin sections stained with 4% uranyl acetate, followed by 1% lead citrate were examined using a Zeiss LEO-912 transmission electron microscope (Zeiss, Germany).

2.5 Immunohistochemistry

For localization of StAR, pieces of HGs were rapidly immersed in Bouin's fluid. Paraffin sections (5 μm thick) were incubated overnight with rabbit anti-StAR polyclonal antibody (diluted 1:50, in 0.1 m PBS at pH 7.4 with 0.1% BSA) (#EAP0193, Elabscience). After washing in PBS, the sections were incubated for 1 h with biotinylated goat antirabbit IgG (Dako) diluted 1:200, followed by incubation for 1 h with peroxidase-conjugated streptavidin (Vector) diluted 1:500. The antigens were visualized using 3,3′-diaminobenzidine tetrahydrochloride (Sigma–Aldrich Corp.) and 0.3% H2O2 Tris buffer (0.05 M, pH 7.6) [35]. For the negative controls, the primary antibody was omitted.

2.6 5α reductase and cytochrome P450 aromatase activities

5α-Red as well as P450 aro enzyme activities were measured by evaluating the in vitro conversion rate of testosterone to 5α-dihydrotestosterone and 17β-estradiol, respectively.

HG and testis (positive control) were homogenized 1:10 in Tris–HCl 0.05 M pH 7.4. After centrifugation at 3000 g for 10 min, 2 ml of supernatant were separately incubated with 2 μM or 18 μM of testosterone as substrate and incubate at 37 °C under shaking [36]. After 5 min, 1 ml of the assay mixture was taken from each sample and mixed with 9 ml of ethylic ether. Then, the samples were centrifuged at 13,000 rpm and the supernatants were dried in appropriate glass Petri dishes at 40–50 °C under shacking under air. The residues were mixed with 0.2 ml of 10 mg/ml bovine serum albumin (BSA) in PBS in order to dissolve the hormones from the Petri dish and then used for the determination of 5α-dihydrotestosterone (Abnova) and 17β-estradiol (Diametra) using the ELISA method [37–39]. The sensitivities were 6 pg/ml for 5α-dihydrotestosterone and 15 pg/ml for 17β-estradiol. The results are expressed as enzymatic units/mg tissue, one unit being defined as the amount of the enzyme that was capable of converting 1.0 nmol of testosterone to 5α-dihydrotestosterone or 17β-estradiol under the assay conditions above.

2.7 Statistical analysis

ANOVA followed by a Student–Newman–Keuls’ test was used to evaluate significant changes between groups. Differences were considered statistically significant at P < 0.05. All data were expressed as the mean ± S.D.

3 Results

3.1 Expression and immunolocalization of steroidogenic acute regulatory protein

Both mRNA and protein for StAR were expressed in the HG of both male and female rats, with significant higher levels in males than in females (Fig. 1A and B).

Fig. 1

A, RT-PCR-analysis of Star in HG from three male and three female rats. The upper panel shows the mRNA levels normalized with respect to β-actin mRNA levels; lower panel, the levels of HG Star was quantified using the ImageJ program and normalized with respect to β-actin mRNA. T, testis; O, ovary: positive controls. B, the upper panel shows Western blot detection of the StAR protein in the HG from three male and three female rats. One specific band, corresponding to the size of 32 KDa was detected; lower panel, the levels of HG the StAR protein were quantified using the ImageJ program and normalized with respect to β-actin protein. T, testis; O, ovary: positive controls. Values shown represent the means ± S.D. of three animals. *P < 0.05; **P < 0.01.

As reported by Chieffi Baccari et al. [40], two cell types are present in rat HG epithelium (Fig. 2A). Type-A cells showed the cytoplasm filled with large secretory vacuoles, whereas type-B cells contained numerous mitochondria and small unstained vacuoles (Fig. 2A). Immunohistochemical analysis revealed that the StAR protein was detected in the cytoplasm of both type A and type B cells, with a more intense immunopositivity in B cells (Fig. 2B).

Fig. 2

A, Electron micrograph of the HG from male rat. Large secretory vacuoles occupy the cytoplasm of type A cells (A); type B cell (B) displays numerous mitochondria (arrows) and small secretory vacuoles. N, nucleus. ×4600; B, Immunohistochemistry for the StAR protein in the HG from male rat. Type B cells showing a strong immunopositivity (arrows) were observed among A cells. X1000; C, StAR antibody-negative control section of HG.

3.2 Gene expression of steroidogenic enzymes

The mRNAs for Cyp11a1, Hsd3b1, Hsd17b3, Srd5a1, Srd5a2 and Cyp19a1 were detectable in the HG of both male and female rats (Fig. 3). Significant differences were observed between sexes in gene expression levels of Hsd17b3, Srd5a1 and Cyp19a1 (Fig. 3). Particularly, Hsd17b3 and Cyp19a1 mRNA levels were higher in males than females, whereas Srd5a1 mRNA levels were higher in females than in males (Fig. 3). No significant differences were observed in mRNA levels of Cyp11a, Hsd3b1and Srd5a2 between sexes.

Fig. 3

RT-PCR-analysis of Cyp11a1, Hsd3b1, Hsd17b3, Srd5a1, Srd5a2 and Cyp19a1 in HG from three male and three female rats. The upper panel shows the mRNA levels normalized with respect to β-actin mRNA levels; lower panel, the levels of HG mRNA steroidogenic enzymes were quantified using the ImageJ program and normalized with respect to β-actin mRNA. T, testis; O, ovary: positive controls. Values shown represent the means ± S.D. of three animals. *P < 0.05; **P < 0.01.

3.3 5α reductase and cytochrome P450 aromatase activities

Rat HG and testis (control tissue) homogenates were incubated with testosterone and 5α-Red or P450 aro enzyme activities were measured by evaluating the in vitro conversion rate of testosterone to 5α-dihydrotestosterone or 17β-estradiol, respectively.

The addition of testosterone to both male and female HG homogenates produced a dose-dependent increase of both 5α-Red and P450 aro activities (Table 2).

Table 2

5α reductase (5α-Red) and cytochrome P450 aromatase (P450 aro) activities in rat HG (enzymatic units/mg tissue).

Table 2
HG Male HG Female
2 μM T 18 μM T 2 μM T 18 μM T
5α-Red 22 ± 9 110 ± 17 37 ± 8 147 ± 9*
P450 aro 17 ± 3* 130 ± 16** 0 52 ± 5

* P < 0.05.

** P < 0.01.

After addition of 2 μM testosterone, no significant differences in 5α-Red activity were observed between sexes, whereas after addition of 18 μM testosterone, a significant higher 5α-Red activity was observed in female than in male HG (Table 2).

After addition of both 2 μM and 18 μM of testosterone, the P450 aro activity was significantly higher in male than in female HG (Table 2).

Following the addition of 2 μM and 18 μM testosterone to testis homogenates 5α-Red activity was 3 ± 1 UE and 21 ± 5 UE, respectively; P450-aro activity was 2 ± 1 UE and 6 ± 2 UE, respectively.

4 Discussion

Numerous studies have clearly demonstrated that HG activity is influenced by steroid hormones and that androgens are responsible for sexual dimorphism in the hamster HG [2,41]. The occurrence of steroidogenic enzymes in HG tissues have not been documented to date, though studies strongly suggest a local synthesis of 5α-dihydrotestosterone due to the presence of 5α-Red activity [20,27]. The biosynthesis of steroid hormones begins upon mobilization of cholesterol from cellular stores to the mitochondrial inner membrane [42–44]. A large body of evidence indicates that the intramitochondrial transport of cholesterol is primarily mediated by the StAR protein, which is considered to be the rate-limiting step in steroid hormone biosynthesis [25,26,41,42,45,46]. In this regard, numerous studies have demonstrated a tight correlation between the synthesis of the StAR protein and the synthesis of steroids in a variety of classical (e.g., adrenal and gonadal) and non-classical (e.g., glial cells and skin) steroidogenic tissues [42,47–50]. The results of the present study demonstrate, for the first time, the expression of the StAR protein in the rat HG. We found a clear sexual dimorphism of StAR mRNA and protein expressions, which were more pronounced in males than in females. Furthermore, immunohistochemical investigations demonstrated that the StAR protein is more represented in B cells than A cells. It has been described that, in the rat HG, A and B cells represent different stages of a secretory cycle, with B cells representing the initial stage and A cells the end of the cycle activity [40,51]. B cells contain more numerous non-swollen mitochondria than A cells, and therefore are likely to display a more intense steroidogenic activity.

The results also demonstrated that the rat HG expresses Cyp11a1 (gene for P450scc), Hsd3b1 (gene for 3β-HSD) and Hsd17b3 (gene for 17β-HSD) and that in males, Hsd17b3 expression levels are far higher than in females. P450scc converts cholesterol to pregnenolone and 17β-HSD catalyzes the conversion of androstenedione to testosterone. In support of this view, it has been reported that both pregnenolone and testosterone elicit physiological effects on the HG [20]. Interestingly, Vilchis et al. [52] isolated the cDNA for P450scc in the HG of Syrian hamster.

Most steroidogenic enzymes present in the HG, such as StAR, P450scc, 3β-HSD and 17β-HSD are involved in de novo steroidogenesis, i.e. starting from the precursor cholesterol, in contrast to other enzymes such as 5α-Red1/2 and P450 aro, which are mainly responsible for the conversion of testosterone in 5α-dihydrotestosterone and 17β-estradiol, respectively [53]. Our results demonstrated that transcripts of 5α-Red1 were higher in the female than in the male rat, whereas those of P450 aro were higher in the male than in the female HG. It is noteworthy that Ramos et al. [28] isolated specific cDNAs for 5α-Red1, 5α-Red2 and 5α-Red3 in the hamster HG. As opposed to 1 and 2 isoforms, 5α-Red3 does not seem to drive the reduction of steroids. In a comparison among the three 5α-Red, the type 3 isozyme was found to have a low identity with type 1 (19%) and type 2 (17%) isozymes, whereas the homology between hamster type 1 and 2 reductases was nearly 40% [54]. However, they found that 5α-Red1 mRNA levels were higher than 5α-Red2, but no sexual dimorphism was shown.

Furthermore, our in vitro experiments demonstrated a higher 5α-Red activity in female as compared to the male HG and vice versa with a higher P450 aro activity in males than in females. This finding suggests a higher conversion rate of testosterone to 5α-dihydrotestosterone in females and a greater conversion of testosterone to 17β-estradiol in males. While there are no data related to P450 aro activity in the HG, Vilchis et al. [27] reported a higher 5α-Red activity in the female than in the male hamster HG. It is known that the HG of the hamster efficiently transforms testosterone to 5α-dihydrotestosterone, a necessary conversion to maintain the male glandular pattern. In fact, the activity of 5α-Red in the HG displays a marked androgen-regulated sexual dimorphism. No evidence of a sexually dimorphic Hsrd5a3 pattern was observed in the HG, suggesting that this expression is not influenced by androgens [54].

It is well known that, in some rodents, the HG is involved in chemical communication. In the gerbil HG exudates act as an attractant pheromone when spread throughout the pelage. The Harderian exudates in the male guide proceptive behavior in the female [10]. It has been speculated that Harderian spread allows the female to assess the reproductive competence of the male. The same findings have been reported by Payne [1] in the golden hamster, where homogenates of female HG lower aggressive male behavior toward other males whose faces are coated with these. We speculate that the sex steroid hormones locally synthesized in HG could be involved in the pheromone secretion and therefore regulate the sexual behavior in males and females.

In conclusion, the results of the present study indicate that Harderian gland can be classified as a steroidogenic tissue because it synthesizes cholesterol, expresses StAR and the steroidogenic enzymes involved in both androgen and estrogen synthesis as well as in the other steroidogenic tissues [46,47]. Finally, the dimorphic expression and activities of steroidogenic enzymes could suggest sex-specific hormonal effects into HG physiology.

Disclosure of interest

The authors declare that they have no competing interest.

Acknowledgements

This work is supported by University of Campania L. Vanvitelli.


References

[1] A.P. Payne The Harderian gland: a tercentennial review, J. Anat., Volume 185 (1994), pp. 1-49

[2] G. Chieffi; G. Chieffi Baccari; L. Di Matteo; M. d’Istria; S. Minucci; B. Varriale Cell biology of the Harderian gland, Int. Rev. Cytol., Volume 168 (1996), pp. 1-80

[3] M. Di Giovanni; E. Topo; A. Santillo; A. D’Aniello; G. Chieffi Baccari D-Aspartate binding sites in rat Harderian gland, Amino Acids, Volume 38 (2010), pp. 229-235

[4] A. Santillo; L. Burrone; S. Minucci; M. Di Giovanni; G. Chieffi Baccari Molecular pathway s involved in the cyclic activity of frog (Pelophylax esculentus) Harderian gland: influence of temperature and testosterone, Comp. Biochem. Physiol. B. Biochem. Mol. Biol., Volume 158 (2011), pp. 71-76

[5] R. Bareggi; A. Crescenzi; P. Narducci-Bareggi Lipids in the Harder's gland of certain rodents, I. Neutral lipids, Basic Appl. Histochem., Volume 23 (1979), pp. 155-160

[6] Y. Seyama; T. Kasama; E. Yasugi; S.H. Park; K. Kano Lipids in Harderian glands and their significance (S.M. Webb; R.A. Hoffman; M.L. Puig-Domingo; R.J. Reiter, eds.), Harderian Glands: Porphyrin, Metabolism, Behavioral and Endocrine Effects, Springer-Verlag, Berlin, 1992, pp. 195-217

[7] Y. Seyama; Y. Uchijima Novel function of lipids as a pheromone from the Harderian gland of golden hamster, Proc. Jpn. Acad. Ser. B Phys. Biol. Sci., Volume 83 (2007), pp. 77-96

[8] D.D. Thiessen Body temperature and grooming in the Mongolian gerbil, Ann. N. Y. Acad. Sci., Volume 525 (1988), pp. 27-39

[9] U. Shanas; J. Terkel Grooming secretions and seasonal adaptations in the blind mole rat (Spalax ehrenbergi), Physiol. Behav., Volume 60 (1996), pp. 653-656

[10] D.D. Thiessen; A.E. Harriman Harderian gland exudates in the male Meriones unguiculatus regulate female proceptive behavior, aggression, and investigation, J. Comp. Psychol., Volume 100 (1986), pp. 85-87

[11] U. Shanas; J. Terkel Mole-rat Harderian gland secretions inhibit aggression, Anim. Behav., Volume 54 (1997), pp. 1255-1263

[12] J. Hugo; J. Krijt; M. Vokurka; V. Janousek Secretory response to light in rat Harderian gland: possible photoprotective role of Harderian porphyrin, Gen. Physiol. Biophys., Volume 6 (1987), pp. 401-404

[13] R.C. Spike; A.P. Payne; G.G. Thompson; M.R. Moore Porphyrin profiles in hamster Harderian glands, Biochem. Soc. Trans., Volume 18 (1990), pp. 630-631

[14] R.A. Hoffman; L.B. Johnson; R.J. Reiter Regulation of melatonin in the Harderian glands of golden hamsters, J. Pineal. Res., Volume 6 (1989), pp. 63-71

[15] Y. Djeridane; B. Vivien-Roels; V. Simonneaux; J.M. Miguez; P. Pevet Evidence for melatonin synthesis in rodent Harderian gland: a dynamic in vitro study, J. Pineal. Res., Volume 25 (1998), pp. 54-64

[16] A. Coto-Montes; C. Tomas-Zapico; G. Escames; J. Leon; M.J. Rodrìguez-Colunga; D. Tolivia; D. Acuna-Castroviejo Specific binding of melatonin to purified cell nuclei from mammary gland of swiss mice: day-night variations and effect of continuous light, J. Pineal. Res., Volume 34 (2003), pp. 297-301

[17] A. Coto-Montes; C. Tomás-Zapico Could melatonin unbalance the equilibrium between autophagy and invasive processes?, Autophagy, Volume 2 (2006), pp. 126-128

[18] I. Vega-Naredo; B. Caballero; V. Sierra; M. García-Macia; D. de Gonzalo-Calvo; P.J. Oliveira; M.J. Rodríguez-Colunga; A. Coto-Montes Melatonin modulates autophagy through a redox-mediated action in female Syrian hamster Harderian gland controlling cell types and gland activity, J. Pineal. Res., Volume 52 (2012), pp. 80-92

[19] F. Vilchis; G. Pérez-Palacios Steroid hormone receptors and the sexual phenotype of the Harderian gland in hamsters, J. Endocrinol., Volume 121 (1989), pp. 149-156

[20] F. Vilchis; B. Chàvez; M.A. Cerbòn; G. Pèrez-Palacios The Harderian gland as a target for steroid hormone action: role and characteristics of intracellular receptors (S.M. Webb; R.A. Hoffman; M.L. Puig-Domingo; R.J. Reiter, eds.), Harderian Glands: Porphyrin Metabolism, Behavioral and Endocrine Effects, Springer, Berlin, 1992, pp. 297-316

[21] F. Vilchis; A. Hernandez; A.E. Perez; G. Perez-Palacios Hormone regulation of the rodent Harderian gland: binding properties of the androgen receptor in the male golden hamster, J. Endocrinol., Volume 112 (1987), pp. 3-8

[22] A.P. Payne; J. McGadey; M.R. Moore; G. Thompson Androgenic control of the Harderian gland in the male golden hamster, J. Endocrinol., Volume 75 (1977), pp. 73-82

[23] G.R. Buzzell Sexual dimorphism in the Harderian gland of the Syrian hamster is controlled and maintained by hormones, despite seasonal fluctuations in hormone levels: functional implications, Microsc. Res. Tech., Volume 34 (1996), pp. 133-138

[24] K. Shirama; T. Furuya; Y. Takeo; K. Shimizu; K. Maekawa Influences of some endocrine glands and of hormone replacement on the porphyrins of the Harderian glands of mice, J. Endocrinol., Volume 91 (1981), pp. 305-311

[25] D.M. Stocco The role of the StAR protein in steroidogenesis: challenges for the future, J. Endocrinol., Volume 164 (2000), pp. 247-253

[26] D.M. Stocco StAR protein and the regulation of steroid hormone biosynthesis, Annu. Rev. Physiol., Volume 63 (2001), pp. 193-213

[27] F. Vilchis; J. Enriquez; G. Queipo; G. Pérez-Palacios; B. Chávez Steroid 5 alpha-reductase activity in the Harderian glands of male and female Syrian hamster (Mesocricetus auratus), Gen. Comp. Endocrinol., Volume 96 (1994), pp. 298-308

[28] L. Ramos; B. Chávez; F. Vilchis Cloning and differential expression of steroid 5 alpha-reductase type 1 (Srd5a1) and type 2 (Srd5a2) from the Harderian glands of hamsters, Gen. Comp. Endocrinol., Volume 166 (2010), pp. 388-395

[29] A. Santillo; S. Falvo; P. Chieffi; L. Burrone; G. Chieffi Baccari; S. Longobardi; M.M. Di Fiore D-aspartate affects NMDA receptor-extracellular signal-regulated kinase pathway and upregulates androgen receptor expression in the rat testis, Theriogenology, Volume 81 (2014), pp. 744-751

[30] R. Monteforte; A. Santillo; A. Lanni; S. D”’Aniello; G. Chieffi Baccari Morphological and biochemical changes in the Harderian gland of hypothyroid rats, J. Exp. Biol., Volume 211 (2008), pp. 606-612

[31] A. Santillo; L. Burrone; R. Senese; F. Cioffi; A. Lanni; G. Chieffi Baccari Effect of d-aspartate uptake on uncoupling protein-3 and α-tubulin expressions in rat Harderian gland, J. Chromatogr. B: Anal. Technol. Biomed. Life Sci., Volume 879 (2011), pp. 3344-3348

[32] L. Burrone; M. Di Giovanni; M.M. Di Fiore; G. Chieffi Baccari; A. Santillo Effects of D-aspartate treatment on D-aspartate oxidase, superoxide dismutase and caspase 3 activities in frog Rana esculenta tissues, Chem. Biodivers., Volume 7 (2010), pp. 1459-1466

[33] F. Raucci; A. Santillo; A. D’Aniello; P. Chieffi; G. Chieffi Baccari d-Aspartate modulates transcriptional activity in Harderian gland of frog, Rana esculenta: Morphological and molecular evidence, J. Cell Physiol., Volume 204 (2005) no. 2, pp. 445-454

[34] A. Santillo; R. Monteforte; F. Raucci; A. D’Aniello; G. Chieffi Baccari Occurrence of D-Aspartate in the Harderian gland of Podarcis s. sicula and its effect on gland secretion, J. Exp. Zool., Volume 305 (2006), pp. 610-619

[35] L. Burrone; A. Santillo; C. Pinelli; G. Chieffi Baccari; M.M. Di Fiore Induced synthesis of P450 aromatase and 17β-estradiol by D-aspartate in frog brain, J. Exp. Biol., Volume 215 (2012) no. 20, pp. 3559-3565

[36] M.M. Di Fiore; A. Santillo; S. Falvo; G. Chieffi Baccari; M. Venditti; F. Di Giacomo Russo; M. Lispi; A. D’Aniello Sex hormone levels in the brain of d-aspartate-treated rats, C. R. Biol., Volume 341 (2018), pp. 9-15

[37] A. Santillo; C. Pinelli; L. Burrone; G. Chieffi Baccari; M.M. Di Fiore d-Aspartic acid implication in the modulation of frog brain sex steroid levels, Gen. Comp. Endocrinol., Volume 181 (2013), pp. 72-76

[38] S. Falvo; M.M. Di Fiore; L. Burrone; G. Chieffi Baccari; S. Longobardi; A. Santillo Androgen and oestrogen modulation by D-aspartate in rat epididymis, Reprod. Fertil. Dev., Volume 28 (2016), pp. 1865-1872

[39] A. Santillo; S. Falvo; G. Chieffi Baccari; M.M. Di Fiore Seasonal changes in gene expression of steroidogenic enzymes, androgen and estrogen receptors in frog testis, Acta Zool., Volume 98 (2017), pp. 221-227

[40] G. Chieffi Baccari; R. Monteforte; P. de Lange; F. Raucci; P. Farina; A. Lanni Thyroid hormone affects secretory activity and uncoupling protein-3 expression in rat Harderian gland, Endocrinology, Volume 145 (2004), pp. 3338-3345

[41] A. Santillo; R. Monteforte; P. De Lange; A. Lanni; P. Farina; G. Chieffi Baccari Dimorphic expression of uncoupling protein-3 in golden hamster Harderian gland: effects of castration and testosterone administration, J. Cell. Physiol., Volume 215 (2008), pp. 481-487

[42] W.L. Miller Steroidogenic acute regulatory protein (StAR), a novel mitochondrial cholesterol transporter, Biochim. Biophys. Acta, Volume 1771 (2007), pp. 663-676

[43] W.L. Miller; H.S. Bose Early steps in steroidogenesis: intracellular cholesterol trafficking, J. Lipid Res., Volume 52 (2011), pp. 2111-2135

[44] P.R. Manna; J. Cohen-Tannoudji; R. Counis; C.W. Garner; I. Huhtaniemi; F.B. Kraemer; D.M. Stocco Mechanisms of action of hormone-sensitive lipase in mouse Leydig cells: its role in the regulation of the steroidogenic acute regulatory protein, J. Biol. Chem., Volume 288 (2013), pp. 8505-8518

[45] D. Lin; T. Sugawara; J.F. Strauss; B.J. Clark; D.M. Stocco; P. Saenger; A. Rogol; W.L. Miller Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis, Science, Volume 267 (1995), pp. 1828-1831

[46] F. Arakane; C.B. Kallen; H. Watari; S.E. Stayrook; M. Lewis; J.F. Strauss Steroidogenic acute regulatory protein (StAR) acts on the outside of mitochondria to stimulate steroidogenesis, Endocr. Res., Volume 24 (1998), pp. 463-468

[47] P.R. Manna; M.T. Dyson; D.M. Stocco Regulation of the steroidogenic acute regulatory protein gene expression: present and future perspectives, Mol. Hum. Reprod., Volume 15 (2009), pp. 321-333

[48] P.R. Manna; C.L. Stetson; A.T. Slominski; K. Pruitt Role of the steroidogenic acute regulatory protein in health and disease, Endocrine, Volume 51 (2016), pp. 7-21

[49] W.L. Miller A brief history of adrenal research: steroidogenesis – the soul of the adrenal, Mol. Cell. Endocrinol., Volume 371 (2013), pp. 5-14

[50] A.T. Slominski; P.R. Manna; R.C. Tuckey On the role of skin in the regulation of local and systemic steroidogenic activities, Steroids, Volume 103 (2015), pp. 72-88

[51] A. Santillo; L. Burrone; S. Falvo; R. Senese; A. Lanni; G. Chieffi Baccari Triiodothyronine induces lipid oxidation and mitochondrial biogenesis in rat Harderian gland, J. Endocrinol., Volume 219 (2013), pp. 69-78

[52] F. Vilchis; B. Chávez; F. Larrea; C. Timossi; F. Montiel The cDNA cloning and tissue expression of the cytochrome P450scc from Syrian hamster (Mesocricetus auratus), Gen. Comp. Endocrinol., Volume 126 (2002), pp. 279-286

[53] J.L. do Rego; J.Y. Seong; D. Burel; J. Leprince; V. Luu-The; K. Tsutsui; M.C. Tonon; G. Pelletier; H. Vaudry Neurosteroid biosynthesis: enzymatic pathways and neuroendocrine regulation by neurotransmitters and neuropeptides, Front. Neuroendocrinol., Volume 30 (2009), pp. 259-301

[54] B. Chávez; L. Ramos; R. García-Becerra; F. Vilchis Hamster SRD5A3 lacks steroid 5α-reductase activity in vitro, Steroids, Volume 94 (2015), pp. 41-50


Comments - Policy